ID: 1090735515

View in Genome Browser
Species Human (GRCh38)
Location 11:129609410-129609432
Sequence TGTCCTCTAGAGTCCCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090735515_1090735527 28 Left 1090735515 11:129609410-129609432 CCTCTGAGGGACTCTAGAGGACA No data
Right 1090735527 11:129609461-129609483 ATGGAAACTGGTGGGCAAAAGGG No data
1090735515_1090735518 -9 Left 1090735515 11:129609410-129609432 CCTCTGAGGGACTCTAGAGGACA No data
Right 1090735518 11:129609424-129609446 TAGAGGACAGCAGAGGCCACGGG No data
1090735515_1090735517 -10 Left 1090735515 11:129609410-129609432 CCTCTGAGGGACTCTAGAGGACA No data
Right 1090735517 11:129609423-129609445 CTAGAGGACAGCAGAGGCCACGG No data
1090735515_1090735524 19 Left 1090735515 11:129609410-129609432 CCTCTGAGGGACTCTAGAGGACA No data
Right 1090735524 11:129609452-129609474 CCTTCTTGCATGGAAACTGGTGG No data
1090735515_1090735521 9 Left 1090735515 11:129609410-129609432 CCTCTGAGGGACTCTAGAGGACA No data
Right 1090735521 11:129609442-129609464 ACGGGGCAAGCCTTCTTGCATGG No data
1090735515_1090735519 -8 Left 1090735515 11:129609410-129609432 CCTCTGAGGGACTCTAGAGGACA No data
Right 1090735519 11:129609425-129609447 AGAGGACAGCAGAGGCCACGGGG No data
1090735515_1090735525 20 Left 1090735515 11:129609410-129609432 CCTCTGAGGGACTCTAGAGGACA No data
Right 1090735525 11:129609453-129609475 CTTCTTGCATGGAAACTGGTGGG No data
1090735515_1090735522 16 Left 1090735515 11:129609410-129609432 CCTCTGAGGGACTCTAGAGGACA No data
Right 1090735522 11:129609449-129609471 AAGCCTTCTTGCATGGAAACTGG No data
1090735515_1090735526 27 Left 1090735515 11:129609410-129609432 CCTCTGAGGGACTCTAGAGGACA No data
Right 1090735526 11:129609460-129609482 CATGGAAACTGGTGGGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090735515 Original CRISPR TGTCCTCTAGAGTCCCTCAG AGG (reversed) Intergenic
No off target data available for this crispr