ID: 1090735518

View in Genome Browser
Species Human (GRCh38)
Location 11:129609424-129609446
Sequence TAGAGGACAGCAGAGGCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090735507_1090735518 20 Left 1090735507 11:129609381-129609403 CCAGCCCTGTTGTGGCCATTGGA No data
Right 1090735518 11:129609424-129609446 TAGAGGACAGCAGAGGCCACGGG No data
1090735511_1090735518 5 Left 1090735511 11:129609396-129609418 CCATTGGATGGCATCCTCTGAGG No data
Right 1090735518 11:129609424-129609446 TAGAGGACAGCAGAGGCCACGGG No data
1090735505_1090735518 24 Left 1090735505 11:129609377-129609399 CCTGCCAGCCCTGTTGTGGCCAT No data
Right 1090735518 11:129609424-129609446 TAGAGGACAGCAGAGGCCACGGG No data
1090735510_1090735518 15 Left 1090735510 11:129609386-129609408 CCTGTTGTGGCCATTGGATGGCA No data
Right 1090735518 11:129609424-129609446 TAGAGGACAGCAGAGGCCACGGG No data
1090735509_1090735518 16 Left 1090735509 11:129609385-129609407 CCCTGTTGTGGCCATTGGATGGC No data
Right 1090735518 11:129609424-129609446 TAGAGGACAGCAGAGGCCACGGG No data
1090735515_1090735518 -9 Left 1090735515 11:129609410-129609432 CCTCTGAGGGACTCTAGAGGACA No data
Right 1090735518 11:129609424-129609446 TAGAGGACAGCAGAGGCCACGGG No data
1090735503_1090735518 30 Left 1090735503 11:129609371-129609393 CCTAGACCTGCCAGCCCTGTTGT No data
Right 1090735518 11:129609424-129609446 TAGAGGACAGCAGAGGCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090735518 Original CRISPR TAGAGGACAGCAGAGGCCAC GGG Intergenic
No off target data available for this crispr