ID: 1090735519

View in Genome Browser
Species Human (GRCh38)
Location 11:129609425-129609447
Sequence AGAGGACAGCAGAGGCCACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090735507_1090735519 21 Left 1090735507 11:129609381-129609403 CCAGCCCTGTTGTGGCCATTGGA No data
Right 1090735519 11:129609425-129609447 AGAGGACAGCAGAGGCCACGGGG No data
1090735509_1090735519 17 Left 1090735509 11:129609385-129609407 CCCTGTTGTGGCCATTGGATGGC No data
Right 1090735519 11:129609425-129609447 AGAGGACAGCAGAGGCCACGGGG No data
1090735515_1090735519 -8 Left 1090735515 11:129609410-129609432 CCTCTGAGGGACTCTAGAGGACA No data
Right 1090735519 11:129609425-129609447 AGAGGACAGCAGAGGCCACGGGG No data
1090735505_1090735519 25 Left 1090735505 11:129609377-129609399 CCTGCCAGCCCTGTTGTGGCCAT No data
Right 1090735519 11:129609425-129609447 AGAGGACAGCAGAGGCCACGGGG No data
1090735510_1090735519 16 Left 1090735510 11:129609386-129609408 CCTGTTGTGGCCATTGGATGGCA No data
Right 1090735519 11:129609425-129609447 AGAGGACAGCAGAGGCCACGGGG No data
1090735511_1090735519 6 Left 1090735511 11:129609396-129609418 CCATTGGATGGCATCCTCTGAGG No data
Right 1090735519 11:129609425-129609447 AGAGGACAGCAGAGGCCACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090735519 Original CRISPR AGAGGACAGCAGAGGCCACG GGG Intergenic
No off target data available for this crispr