ID: 1090735520

View in Genome Browser
Species Human (GRCh38)
Location 11:129609440-129609462
Sequence ATGCAAGAAGGCTTGCCCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090735520_1090735526 -3 Left 1090735520 11:129609440-129609462 CCACGGGGCAAGCCTTCTTGCAT No data
Right 1090735526 11:129609460-129609482 CATGGAAACTGGTGGGCAAAAGG No data
1090735520_1090735527 -2 Left 1090735520 11:129609440-129609462 CCACGGGGCAAGCCTTCTTGCAT No data
Right 1090735527 11:129609461-129609483 ATGGAAACTGGTGGGCAAAAGGG No data
1090735520_1090735529 3 Left 1090735520 11:129609440-129609462 CCACGGGGCAAGCCTTCTTGCAT No data
Right 1090735529 11:129609466-129609488 AACTGGTGGGCAAAAGGGATGGG No data
1090735520_1090735525 -10 Left 1090735520 11:129609440-129609462 CCACGGGGCAAGCCTTCTTGCAT No data
Right 1090735525 11:129609453-129609475 CTTCTTGCATGGAAACTGGTGGG No data
1090735520_1090735531 13 Left 1090735520 11:129609440-129609462 CCACGGGGCAAGCCTTCTTGCAT No data
Right 1090735531 11:129609476-129609498 CAAAAGGGATGGGCAGGTGTAGG No data
1090735520_1090735528 2 Left 1090735520 11:129609440-129609462 CCACGGGGCAAGCCTTCTTGCAT No data
Right 1090735528 11:129609465-129609487 AAACTGGTGGGCAAAAGGGATGG No data
1090735520_1090735532 14 Left 1090735520 11:129609440-129609462 CCACGGGGCAAGCCTTCTTGCAT No data
Right 1090735532 11:129609477-129609499 AAAAGGGATGGGCAGGTGTAGGG No data
1090735520_1090735530 7 Left 1090735520 11:129609440-129609462 CCACGGGGCAAGCCTTCTTGCAT No data
Right 1090735530 11:129609470-129609492 GGTGGGCAAAAGGGATGGGCAGG No data
1090735520_1090735533 15 Left 1090735520 11:129609440-129609462 CCACGGGGCAAGCCTTCTTGCAT No data
Right 1090735533 11:129609478-129609500 AAAGGGATGGGCAGGTGTAGGGG No data
1090735520_1090735534 18 Left 1090735520 11:129609440-129609462 CCACGGGGCAAGCCTTCTTGCAT No data
Right 1090735534 11:129609481-129609503 GGGATGGGCAGGTGTAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090735520 Original CRISPR ATGCAAGAAGGCTTGCCCCG TGG (reversed) Intergenic
No off target data available for this crispr