ID: 1090735521

View in Genome Browser
Species Human (GRCh38)
Location 11:129609442-129609464
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090735511_1090735521 23 Left 1090735511 11:129609396-129609418 CCATTGGATGGCATCCTCTGAGG No data
Right 1090735521 11:129609442-129609464 ACGGGGCAAGCCTTCTTGCATGG No data
1090735515_1090735521 9 Left 1090735515 11:129609410-129609432 CCTCTGAGGGACTCTAGAGGACA No data
Right 1090735521 11:129609442-129609464 ACGGGGCAAGCCTTCTTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090735521 Original CRISPR ACGGGGCAAGCCTTCTTGCA TGG Intergenic
No off target data available for this crispr