ID: 1090735523

View in Genome Browser
Species Human (GRCh38)
Location 11:129609452-129609474
Sequence CCACCAGTTTCCATGCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090735523_1090735531 1 Left 1090735523 11:129609452-129609474 CCTTCTTGCATGGAAACTGGTGG No data
Right 1090735531 11:129609476-129609498 CAAAAGGGATGGGCAGGTGTAGG No data
1090735523_1090735532 2 Left 1090735523 11:129609452-129609474 CCTTCTTGCATGGAAACTGGTGG No data
Right 1090735532 11:129609477-129609499 AAAAGGGATGGGCAGGTGTAGGG No data
1090735523_1090735529 -9 Left 1090735523 11:129609452-129609474 CCTTCTTGCATGGAAACTGGTGG No data
Right 1090735529 11:129609466-129609488 AACTGGTGGGCAAAAGGGATGGG No data
1090735523_1090735534 6 Left 1090735523 11:129609452-129609474 CCTTCTTGCATGGAAACTGGTGG No data
Right 1090735534 11:129609481-129609503 GGGATGGGCAGGTGTAGGGGTGG No data
1090735523_1090735530 -5 Left 1090735523 11:129609452-129609474 CCTTCTTGCATGGAAACTGGTGG No data
Right 1090735530 11:129609470-129609492 GGTGGGCAAAAGGGATGGGCAGG No data
1090735523_1090735533 3 Left 1090735523 11:129609452-129609474 CCTTCTTGCATGGAAACTGGTGG No data
Right 1090735533 11:129609478-129609500 AAAGGGATGGGCAGGTGTAGGGG No data
1090735523_1090735528 -10 Left 1090735523 11:129609452-129609474 CCTTCTTGCATGGAAACTGGTGG No data
Right 1090735528 11:129609465-129609487 AAACTGGTGGGCAAAAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090735523 Original CRISPR CCACCAGTTTCCATGCAAGA AGG (reversed) Intergenic