ID: 1090735526

View in Genome Browser
Species Human (GRCh38)
Location 11:129609460-129609482
Sequence CATGGAAACTGGTGGGCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090735520_1090735526 -3 Left 1090735520 11:129609440-129609462 CCACGGGGCAAGCCTTCTTGCAT No data
Right 1090735526 11:129609460-129609482 CATGGAAACTGGTGGGCAAAAGG No data
1090735515_1090735526 27 Left 1090735515 11:129609410-129609432 CCTCTGAGGGACTCTAGAGGACA No data
Right 1090735526 11:129609460-129609482 CATGGAAACTGGTGGGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090735526 Original CRISPR CATGGAAACTGGTGGGCAAA AGG Intergenic
No off target data available for this crispr