ID: 1090735529

View in Genome Browser
Species Human (GRCh38)
Location 11:129609466-129609488
Sequence AACTGGTGGGCAAAAGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090735520_1090735529 3 Left 1090735520 11:129609440-129609462 CCACGGGGCAAGCCTTCTTGCAT No data
Right 1090735529 11:129609466-129609488 AACTGGTGGGCAAAAGGGATGGG No data
1090735523_1090735529 -9 Left 1090735523 11:129609452-129609474 CCTTCTTGCATGGAAACTGGTGG No data
Right 1090735529 11:129609466-129609488 AACTGGTGGGCAAAAGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090735529 Original CRISPR AACTGGTGGGCAAAAGGGAT GGG Intergenic