ID: 1090735531

View in Genome Browser
Species Human (GRCh38)
Location 11:129609476-129609498
Sequence CAAAAGGGATGGGCAGGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090735520_1090735531 13 Left 1090735520 11:129609440-129609462 CCACGGGGCAAGCCTTCTTGCAT No data
Right 1090735531 11:129609476-129609498 CAAAAGGGATGGGCAGGTGTAGG No data
1090735523_1090735531 1 Left 1090735523 11:129609452-129609474 CCTTCTTGCATGGAAACTGGTGG No data
Right 1090735531 11:129609476-129609498 CAAAAGGGATGGGCAGGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090735531 Original CRISPR CAAAAGGGATGGGCAGGTGT AGG Intergenic
No off target data available for this crispr