ID: 1090735533

View in Genome Browser
Species Human (GRCh38)
Location 11:129609478-129609500
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090735520_1090735533 15 Left 1090735520 11:129609440-129609462 CCACGGGGCAAGCCTTCTTGCAT No data
Right 1090735533 11:129609478-129609500 AAAGGGATGGGCAGGTGTAGGGG No data
1090735523_1090735533 3 Left 1090735523 11:129609452-129609474 CCTTCTTGCATGGAAACTGGTGG No data
Right 1090735533 11:129609478-129609500 AAAGGGATGGGCAGGTGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090735533 Original CRISPR AAAGGGATGGGCAGGTGTAG GGG Intergenic