ID: 1090737024

View in Genome Browser
Species Human (GRCh38)
Location 11:129618913-129618935
Sequence CTGGAAATAGAGAGCTACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090737020_1090737024 18 Left 1090737020 11:129618872-129618894 CCCAGCAGTCAGAGTGAGAGGAA No data
Right 1090737024 11:129618913-129618935 CTGGAAATAGAGAGCTACCAGGG No data
1090737021_1090737024 17 Left 1090737021 11:129618873-129618895 CCAGCAGTCAGAGTGAGAGGAAG No data
Right 1090737024 11:129618913-129618935 CTGGAAATAGAGAGCTACCAGGG No data
1090737019_1090737024 19 Left 1090737019 11:129618871-129618893 CCCCAGCAGTCAGAGTGAGAGGA No data
Right 1090737024 11:129618913-129618935 CTGGAAATAGAGAGCTACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090737024 Original CRISPR CTGGAAATAGAGAGCTACCA GGG Intergenic
No off target data available for this crispr