ID: 1090742186

View in Genome Browser
Species Human (GRCh38)
Location 11:129674482-129674504
Sequence AAACGCTTACTTATATTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090742186_1090742193 24 Left 1090742186 11:129674482-129674504 CCAGTAAATATAAGTAAGCGTTT No data
Right 1090742193 11:129674529-129674551 CAAATTATCGAACCTGAGGAGGG 0: 2
1: 43
2: 120
3: 236
4: 431
1090742186_1090742194 25 Left 1090742186 11:129674482-129674504 CCAGTAAATATAAGTAAGCGTTT No data
Right 1090742194 11:129674530-129674552 AAATTATCGAACCTGAGGAGGGG 0: 2
1: 36
2: 101
3: 201
4: 399
1090742186_1090742191 20 Left 1090742186 11:129674482-129674504 CCAGTAAATATAAGTAAGCGTTT No data
Right 1090742191 11:129674525-129674547 CCAGCAAATTATCGAACCTGAGG No data
1090742186_1090742192 23 Left 1090742186 11:129674482-129674504 CCAGTAAATATAAGTAAGCGTTT No data
Right 1090742192 11:129674528-129674550 GCAAATTATCGAACCTGAGGAGG 0: 2
1: 44
2: 123
3: 215
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090742186 Original CRISPR AAACGCTTACTTATATTTAC TGG (reversed) Intergenic
No off target data available for this crispr