ID: 1090749138

View in Genome Browser
Species Human (GRCh38)
Location 11:129730748-129730770
Sequence GAGTAGCCGCAGGAGAGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090749130_1090749138 2 Left 1090749130 11:129730723-129730745 CCATTCCCCAAATAGCCCTGTTA No data
Right 1090749138 11:129730748-129730770 GAGTAGCCGCAGGAGAGTGGTGG No data
1090749133_1090749138 -5 Left 1090749133 11:129730730-129730752 CCAAATAGCCCTGTTACTGAGTA No data
Right 1090749138 11:129730748-129730770 GAGTAGCCGCAGGAGAGTGGTGG No data
1090749132_1090749138 -4 Left 1090749132 11:129730729-129730751 CCCAAATAGCCCTGTTACTGAGT No data
Right 1090749138 11:129730748-129730770 GAGTAGCCGCAGGAGAGTGGTGG No data
1090749131_1090749138 -3 Left 1090749131 11:129730728-129730750 CCCCAAATAGCCCTGTTACTGAG No data
Right 1090749138 11:129730748-129730770 GAGTAGCCGCAGGAGAGTGGTGG No data
1090749129_1090749138 6 Left 1090749129 11:129730719-129730741 CCAACCATTCCCCAAATAGCCCT No data
Right 1090749138 11:129730748-129730770 GAGTAGCCGCAGGAGAGTGGTGG No data
1090749128_1090749138 14 Left 1090749128 11:129730711-129730733 CCTGTATTCCAACCATTCCCCAA No data
Right 1090749138 11:129730748-129730770 GAGTAGCCGCAGGAGAGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090749138 Original CRISPR GAGTAGCCGCAGGAGAGTGG TGG Intergenic
No off target data available for this crispr