ID: 1090750044

View in Genome Browser
Species Human (GRCh38)
Location 11:129738628-129738650
Sequence CAAATTACTTTAAAGGTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090750044_1090750047 14 Left 1090750044 11:129738628-129738650 CCCAAAACCTTTAAAGTAATTTG No data
Right 1090750047 11:129738665-129738687 GTAACTGTAGACAAAGAGTCAGG No data
1090750044_1090750048 18 Left 1090750044 11:129738628-129738650 CCCAAAACCTTTAAAGTAATTTG No data
Right 1090750048 11:129738669-129738691 CTGTAGACAAAGAGTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090750044 Original CRISPR CAAATTACTTTAAAGGTTTT GGG (reversed) Intergenic
No off target data available for this crispr