ID: 1090750045

View in Genome Browser
Species Human (GRCh38)
Location 11:129738629-129738651
Sequence GCAAATTACTTTAAAGGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090750045_1090750047 13 Left 1090750045 11:129738629-129738651 CCAAAACCTTTAAAGTAATTTGC No data
Right 1090750047 11:129738665-129738687 GTAACTGTAGACAAAGAGTCAGG No data
1090750045_1090750048 17 Left 1090750045 11:129738629-129738651 CCAAAACCTTTAAAGTAATTTGC No data
Right 1090750048 11:129738669-129738691 CTGTAGACAAAGAGTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090750045 Original CRISPR GCAAATTACTTTAAAGGTTT TGG (reversed) Intergenic
No off target data available for this crispr