ID: 1090750047

View in Genome Browser
Species Human (GRCh38)
Location 11:129738665-129738687
Sequence GTAACTGTAGACAAAGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090750045_1090750047 13 Left 1090750045 11:129738629-129738651 CCAAAACCTTTAAAGTAATTTGC No data
Right 1090750047 11:129738665-129738687 GTAACTGTAGACAAAGAGTCAGG No data
1090750044_1090750047 14 Left 1090750044 11:129738628-129738650 CCCAAAACCTTTAAAGTAATTTG No data
Right 1090750047 11:129738665-129738687 GTAACTGTAGACAAAGAGTCAGG No data
1090750046_1090750047 7 Left 1090750046 11:129738635-129738657 CCTTTAAAGTAATTTGCTTCTGT No data
Right 1090750047 11:129738665-129738687 GTAACTGTAGACAAAGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090750047 Original CRISPR GTAACTGTAGACAAAGAGTC AGG Intergenic
No off target data available for this crispr