ID: 1090750206

View in Genome Browser
Species Human (GRCh38)
Location 11:129739986-129740008
Sequence CCAGCTGCACACTTGGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090750206_1090750210 16 Left 1090750206 11:129739986-129740008 CCAAAATCCAAGTGTGCAGCTGG No data
Right 1090750210 11:129740025-129740047 AATGTAGCAAATCCACACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090750206 Original CRISPR CCAGCTGCACACTTGGATTT TGG (reversed) Intergenic
No off target data available for this crispr