ID: 1090752957

View in Genome Browser
Species Human (GRCh38)
Location 11:129763550-129763572
Sequence TAGCCCTCCCCAATGACCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090752957_1090752961 -3 Left 1090752957 11:129763550-129763572 CCAGGGGTCATTGGGGAGGGCTA No data
Right 1090752961 11:129763570-129763592 CTACCAGAGGCACTGGGAAAAGG No data
1090752957_1090752964 5 Left 1090752957 11:129763550-129763572 CCAGGGGTCATTGGGGAGGGCTA No data
Right 1090752964 11:129763578-129763600 GGCACTGGGAAAAGGCCACAGGG 0: 15
1: 36
2: 82
3: 99
4: 435
1090752957_1090752960 -9 Left 1090752957 11:129763550-129763572 CCAGGGGTCATTGGGGAGGGCTA No data
Right 1090752960 11:129763564-129763586 GGAGGGCTACCAGAGGCACTGGG No data
1090752957_1090752963 4 Left 1090752957 11:129763550-129763572 CCAGGGGTCATTGGGGAGGGCTA No data
Right 1090752963 11:129763577-129763599 AGGCACTGGGAAAAGGCCACAGG 0: 18
1: 36
2: 74
3: 96
4: 446
1090752957_1090752959 -10 Left 1090752957 11:129763550-129763572 CCAGGGGTCATTGGGGAGGGCTA No data
Right 1090752959 11:129763563-129763585 GGGAGGGCTACCAGAGGCACTGG No data
1090752957_1090752965 11 Left 1090752957 11:129763550-129763572 CCAGGGGTCATTGGGGAGGGCTA No data
Right 1090752965 11:129763584-129763606 GGGAAAAGGCCACAGGGAGAAGG 0: 25
1: 85
2: 115
3: 318
4: 928

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090752957 Original CRISPR TAGCCCTCCCCAATGACCCC TGG (reversed) Intergenic
No off target data available for this crispr