ID: 1090755516

View in Genome Browser
Species Human (GRCh38)
Location 11:129786540-129786562
Sequence CGCACGGGTGGAGCTGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090755516_1090755523 5 Left 1090755516 11:129786540-129786562 CCTTGGGCAGCTCCACCCGTGCG No data
Right 1090755523 11:129786568-129786590 GCAGGGTACAGCTTCCCTCCTGG No data
1090755516_1090755524 18 Left 1090755516 11:129786540-129786562 CCTTGGGCAGCTCCACCCGTGCG No data
Right 1090755524 11:129786581-129786603 TCCCTCCTGGCTGCTTTCACAGG 0: 168
1: 500
2: 896
3: 1064
4: 1267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090755516 Original CRISPR CGCACGGGTGGAGCTGCCCA AGG (reversed) Intergenic
No off target data available for this crispr