ID: 1090755523

View in Genome Browser
Species Human (GRCh38)
Location 11:129786568-129786590
Sequence GCAGGGTACAGCTTCCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090755514_1090755523 12 Left 1090755514 11:129786533-129786555 CCCAGTGCCTTGGGCAGCTCCAC No data
Right 1090755523 11:129786568-129786590 GCAGGGTACAGCTTCCCTCCTGG No data
1090755521_1090755523 -10 Left 1090755521 11:129786555-129786577 CCCGTGCGGCTTTGCAGGGTACA No data
Right 1090755523 11:129786568-129786590 GCAGGGTACAGCTTCCCTCCTGG No data
1090755520_1090755523 -7 Left 1090755520 11:129786552-129786574 CCACCCGTGCGGCTTTGCAGGGT No data
Right 1090755523 11:129786568-129786590 GCAGGGTACAGCTTCCCTCCTGG No data
1090755516_1090755523 5 Left 1090755516 11:129786540-129786562 CCTTGGGCAGCTCCACCCGTGCG No data
Right 1090755523 11:129786568-129786590 GCAGGGTACAGCTTCCCTCCTGG No data
1090755515_1090755523 11 Left 1090755515 11:129786534-129786556 CCAGTGCCTTGGGCAGCTCCACC No data
Right 1090755523 11:129786568-129786590 GCAGGGTACAGCTTCCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090755523 Original CRISPR GCAGGGTACAGCTTCCCTCC TGG Intergenic
No off target data available for this crispr