ID: 1090766861

View in Genome Browser
Species Human (GRCh38)
Location 11:129883841-129883863
Sequence CAGTGTCACTGTAACGATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 68}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090766856_1090766861 24 Left 1090766856 11:129883794-129883816 CCTAACCTCTTGAGCACTGCTGA 0: 1
1: 0
2: 0
3: 14
4: 140
Right 1090766861 11:129883841-129883863 CAGTGTCACTGTAACGATTAAGG 0: 1
1: 0
2: 0
3: 5
4: 68
1090766855_1090766861 25 Left 1090766855 11:129883793-129883815 CCCTAACCTCTTGAGCACTGCTG 0: 1
1: 0
2: 0
3: 15
4: 163
Right 1090766861 11:129883841-129883863 CAGTGTCACTGTAACGATTAAGG 0: 1
1: 0
2: 0
3: 5
4: 68
1090766858_1090766861 19 Left 1090766858 11:129883799-129883821 CCTCTTGAGCACTGCTGAGGTGG 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1090766861 11:129883841-129883863 CAGTGTCACTGTAACGATTAAGG 0: 1
1: 0
2: 0
3: 5
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090766861 Original CRISPR CAGTGTCACTGTAACGATTA AGG Intronic
900217569 1:1489896-1489918 CAGAGTCCCTGTCAAGATTATGG - Intronic
907714126 1:56912011-56912033 CAGGATCACTGTGAGGATTAAGG + Intronic
909952736 1:81738676-81738698 CAGTTTCACTGTATGGAATAGGG - Intronic
910076802 1:83290371-83290393 TAGTGTCACTGCCATGATTAAGG + Intergenic
918641419 1:186845400-186845422 CACTGTCTCTGTGAGGATTAGGG + Intronic
1065487816 10:26251871-26251893 CAATGTCACTTAAACCATTAGGG - Intronic
1067803620 10:49377516-49377538 CAGTGACACTGTACCCATTCTGG + Intronic
1070127783 10:73635840-73635862 CAGTGTCACTGTCACCAGTGAGG - Intronic
1075625151 10:123958743-123958765 TAATTTCACTGTAACAATTATGG + Intergenic
1079805490 11:24924858-24924880 CAGTGTCAATGTTAAGATAAGGG + Intronic
1083160996 11:60854049-60854071 CAGTGTCATTGTGATGATTATGG + Intronic
1085244652 11:75090398-75090420 CACTTTCACTGCAATGATTAGGG + Intergenic
1085430428 11:76443576-76443598 CAGTGTGACAGGTACGATTAAGG - Intergenic
1086606962 11:88707341-88707363 TAGTGTCACTGTAAACATAAAGG + Intronic
1089720340 11:120412768-120412790 CAGTGTCATTATAAGAATTAGGG - Intronic
1090766861 11:129883841-129883863 CAGTGTCACTGTAACGATTAAGG + Intronic
1092447034 12:8567518-8567540 CAGTGACACTGTAACATTTTGGG - Intergenic
1097311741 12:58126682-58126704 CATGGTCACTGTAGCTATTAGGG - Intergenic
1101240814 12:102837720-102837742 CAGTGTCACTCTAACAATGAGGG - Exonic
1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG + Intronic
1111062788 13:83045332-83045354 CTGTCTCAGTGTAAAGATTAGGG - Intergenic
1112915895 13:104550068-104550090 CACTGTCACTCTAATGCTTAGGG - Intergenic
1127447282 15:59077025-59077047 CAGTTTCACTGTACAGATTCTGG - Intronic
1130164630 15:81440747-81440769 CAGTATTACAGGAACGATTAGGG - Intergenic
1131238600 15:90718468-90718490 GTGTGTCACTGTCAAGATTAAGG + Intronic
1142928585 17:3262407-3262429 CAGTGTCACTGTGAGGGTGAAGG - Intergenic
1142961408 17:3554508-3554530 CAGTGTGACTGGCACAATTAGGG - Intronic
1158238149 18:55343086-55343108 AAGTGTCACTGTTACCATTAGGG - Intronic
1159150114 18:64511554-64511576 TAGTGTCACTTTTAAGATTATGG + Intergenic
926583352 2:14656556-14656578 CAGTGTCACTGACACTATAATGG + Intergenic
928800566 2:35085559-35085581 CAGTGTGTCTATAACCATTATGG - Intergenic
936671402 2:114661519-114661541 CCGTGTCCCTGTAAGGATTCAGG + Intronic
946109108 2:217398626-217398648 CAAAGTCTCTGTAATGATTAAGG + Intronic
948919501 2:241055521-241055543 CACTGTCACTGTAATGTTAAAGG + Intronic
1169043788 20:2519287-2519309 CAGTGTCACAGTCAGGATTAGGG - Intronic
1177306167 21:19319204-19319226 CAGTGACACAGTGAGGATTAAGG - Intergenic
1179324867 21:40332420-40332442 CAGAGTCACTGTATTAATTAAGG + Intronic
953702182 3:45205356-45205378 CAGAGTCACTTTAATGATGAAGG + Intergenic
955167485 3:56528672-56528694 CAGTTTCAGTGGAACAATTAAGG + Intergenic
955542511 3:59992823-59992845 CAGTGTCAGTGTAAAGACTCAGG + Intronic
956145388 3:66186524-66186546 CAGTGTCAGGGTAAAGGTTAGGG - Intronic
958021922 3:88008047-88008069 GAGTGTAACTGTAAATATTAAGG + Intergenic
963895938 3:150684951-150684973 CAGTGTAAGTGGCACGATTATGG - Intronic
966579923 3:181549575-181549597 CAATGTCAATGTAGTGATTAGGG - Intergenic
969577333 4:8044048-8044070 CAGTGGCACTGTCAGGATTAAGG + Intronic
974776180 4:66484866-66484888 CAGTTTCACTATAAAGATAAGGG - Intergenic
975048207 4:69828957-69828979 CAGTGTCTCTGCAAAGATTGTGG + Intronic
975285495 4:72613851-72613873 CAGTGTCACTCTAATGGTTTAGG - Intergenic
980323436 4:131308904-131308926 CAGTGTTAGAATAACGATTAGGG - Intergenic
982233900 4:153234277-153234299 CAGTGTGACTGCAAGGATAAAGG - Intronic
991575683 5:68101006-68101028 CAGTGTTACTGCAATGATTTGGG + Intergenic
1007047919 6:38796404-38796426 CAGTGTCCCTGTAAGCATTTTGG + Intronic
1010706264 6:79114976-79114998 TAGTGGCACTCTAACGATTGAGG - Intergenic
1019838593 7:3416138-3416160 CATTGTCAAGGTAATGATTATGG + Intronic
1020366356 7:7384792-7384814 CAGTGTCAGTTTAATGTTTAGGG - Intronic
1022368966 7:29752525-29752547 CAGTGTCTCTGTAAGGTTTTTGG + Intergenic
1024414839 7:49094970-49094992 CTGTGTCCCTGTAAAGATTTGGG - Intergenic
1027294568 7:76755599-76755621 TAGTGTCACTGCCATGATTAAGG + Intergenic
1027946588 7:84753763-84753785 CAGTAACACTGTAATGATCATGG - Intergenic
1028383801 7:90229590-90229612 CAGAGTCCCTGTAATGATGATGG + Intronic
1031198591 7:118648234-118648256 CAGTCTCACTGTTACCAATAAGG + Intergenic
1033444322 7:141406911-141406933 CAGTTTCACTGTAATGAATTAGG + Intronic
1043229492 8:77783842-77783864 CAGTGTCAGTGCAATGATAAAGG + Intergenic
1043983413 8:86666525-86666547 TAGTGTCATTGAAAGGATTAAGG + Intronic
1046063267 8:109164584-109164606 CAGGATAACTGTAAGGATTAAGG + Intergenic
1047019243 8:120757119-120757141 CAGTGTTGTTGTAAGGATTAGGG - Intronic
1058098989 9:100897397-100897419 CTTTTTCACTGTAAAGATTAAGG + Intergenic
1061200754 9:129137207-129137229 CAGTGTCACTGAGAAGATTCGGG - Intronic
1187779149 X:22797952-22797974 CATTGTCTCTGCAAAGATTACGG - Intergenic
1197546701 X:127834113-127834135 TAGAGTTACTGTAAGGATTAAGG + Intergenic
1197858554 X:130945716-130945738 CAGTGTCACTGTGAGGGCTATGG - Intergenic
1197881603 X:131172337-131172359 CAGGGTTACTGTAAGGATTTTGG + Intergenic
1201855472 Y:18536019-18536041 CAGTGTCAGTGTCATGTTTAGGG + Intergenic
1201877849 Y:18784366-18784388 CAGTGTCAGTGTCATGTTTAGGG - Intronic