ID: 1090768964

View in Genome Browser
Species Human (GRCh38)
Location 11:129902394-129902416
Sequence GCTGTTGGTCTGGGGGTCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 253}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090768954_1090768964 22 Left 1090768954 11:129902349-129902371 CCCGTTGGTGGTGGTGGTGATGA 0: 1
1: 4
2: 11
3: 81
4: 505
Right 1090768964 11:129902394-129902416 GCTGTTGGTCTGGGGGTCCAGGG 0: 1
1: 0
2: 0
3: 28
4: 253
1090768955_1090768964 21 Left 1090768955 11:129902350-129902372 CCGTTGGTGGTGGTGGTGATGAT 0: 1
1: 0
2: 12
3: 83
4: 392
Right 1090768964 11:129902394-129902416 GCTGTTGGTCTGGGGGTCCAGGG 0: 1
1: 0
2: 0
3: 28
4: 253
1090768953_1090768964 27 Left 1090768953 11:129902344-129902366 CCGTTCCCGTTGGTGGTGGTGGT 0: 1
1: 0
2: 5
3: 19
4: 141
Right 1090768964 11:129902394-129902416 GCTGTTGGTCTGGGGGTCCAGGG 0: 1
1: 0
2: 0
3: 28
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090768964 Original CRISPR GCTGTTGGTCTGGGGGTCCA GGG Exonic