ID: 1090769390

View in Genome Browser
Species Human (GRCh38)
Location 11:129906447-129906469
Sequence GACCCCTGGATTTCAACGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090769390_1090769395 20 Left 1090769390 11:129906447-129906469 CCAGGCGTTGAAATCCAGGGGTC 0: 1
1: 0
2: 0
3: 6
4: 119
Right 1090769395 11:129906490-129906512 CACACACAACCCTATCACCTTGG 0: 1
1: 0
2: 1
3: 26
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090769390 Original CRISPR GACCCCTGGATTTCAACGCC TGG (reversed) Intronic
901008594 1:6184308-6184330 GACCCACGTATTTCAACACCTGG + Intronic
906821157 1:48931720-48931742 GAGCCCTGGAATTCAAGACCAGG - Intronic
908245936 1:62227796-62227818 GACCTCTGAACTTCAAGGCCTGG + Intergenic
911111928 1:94198260-94198282 GAGCCCAGGAATTCAACACCAGG + Intronic
915304385 1:154969392-154969414 GTGCCCTGGACTTCAACACCCGG - Exonic
918427064 1:184421317-184421339 GAGCCCAGGAGTTCAAGGCCAGG - Intronic
918486784 1:185037431-185037453 GAGCCCAGGATTTCAAGACCAGG + Intergenic
921538566 1:216383912-216383934 GAGTCCAGGATTTCAAGGCCAGG - Intronic
923008306 1:230068611-230068633 GACCCCTAAATGTCCACGCCGGG + Intronic
924673299 1:246150701-246150723 AACCCCTGGACTTCCACGGCTGG - Intronic
1064189118 10:13189862-13189884 CACCCCTGGATTACAGCGTCAGG - Intronic
1066747787 10:38618637-38618659 GAGCCCAGGAGTTCAAGGCCAGG + Intergenic
1067095928 10:43299849-43299871 GACCCATGGATTCCAACTACAGG - Intergenic
1067723982 10:48752267-48752289 GAACCCTAAATTTCAACCCCAGG - Intronic
1068003626 10:51366943-51366965 GACACCTGGATTACAACACTTGG - Intronic
1070622422 10:78023564-78023586 GAACCCAGGAGTTCAAAGCCTGG + Intronic
1074999725 10:118786776-118786798 GACACCTGGATTTCGACTTCTGG - Intergenic
1075123851 10:119683935-119683957 GACCCCAGGATTTGAATTCCAGG - Intergenic
1075803305 10:125166684-125166706 GACATCTGGAGTTCATCGCCAGG + Intergenic
1076750307 10:132538909-132538931 GAACCCTGAATTTCAACCTCAGG + Intronic
1077487597 11:2846178-2846200 GACCCCTGGAGTGCACGGCCAGG + Intronic
1078379177 11:10824455-10824477 GAGCCCTGGAGTTCAAGACCAGG - Intronic
1081577906 11:44330694-44330716 GACCCCTTGATTTGGACTCCTGG + Intergenic
1084583731 11:70041289-70041311 GACCCCTGGATCACAAAGCAAGG + Intergenic
1086379964 11:86242402-86242424 GAGCCCGGGATATCAAAGCCAGG - Intergenic
1088599157 11:111460247-111460269 GACCCCTGGACTAGAAAGCCTGG + Intergenic
1088936054 11:114401003-114401025 GACCCCTGGATCTCTACCACGGG - Intronic
1089159202 11:116424574-116424596 GACCCCTTGAGTTCAAAGCTGGG + Intergenic
1089718700 11:120390759-120390781 GAACCCTTGCTTTCAACCCCTGG - Intronic
1089826783 11:121284883-121284905 GACCCATGGATTCCAACTACAGG + Intergenic
1090278135 11:125433747-125433769 GATCCCTGGGATTCAAGGCCGGG - Intergenic
1090769390 11:129906447-129906469 GACCCCTGGATTTCAACGCCTGG - Intronic
1094841674 12:34344968-34344990 GACCCCTGCTCTTCCACGCCGGG + Intergenic
1096930320 12:55200692-55200714 GCCCCCTTGATTTCAAAGCTAGG - Intergenic
1098531223 12:71543872-71543894 GACCCCTAGATTTTAAACCCTGG + Intronic
1103199668 12:119077256-119077278 GACCCCAGGATTTGAAGGCAAGG - Intronic
1103870522 12:124087881-124087903 GACCCCTGGCTTGCAATGCACGG - Intronic
1107498477 13:40952607-40952629 GAGCCCAGGAATTCAAGGCCTGG - Intronic
1116920605 14:50569135-50569157 GAGCCCTGGAGTTCAAGACCAGG + Intronic
1123985454 15:25642339-25642361 GAGTCTTGGATTTCAAAGCCTGG + Intergenic
1124342786 15:28900943-28900965 GACCCCTGGATCCCAGCACCTGG + Intronic
1126915547 15:53462184-53462206 GACCCCTGAATTAAAACCCCAGG + Intergenic
1130555153 15:84917485-84917507 GAGCCCAGGAGTTCAAGGCCAGG - Intronic
1131649495 15:94383413-94383435 GGCCGCTGGCTTTCAAGGCCTGG + Intronic
1131963244 15:97810580-97810602 GACCCCTGGATTCCAACTTCTGG + Intergenic
1133753442 16:8742955-8742977 GAGCCCAGGAGTTCAACGCCAGG + Intronic
1134121687 16:11588279-11588301 GAGCCCAGGAGTTCAAGGCCAGG + Intronic
1134587326 16:15423106-15423128 GAGCCCAGGAGTTCAAGGCCAGG - Intronic
1136734966 16:32458659-32458681 GAGCCCAGGAGTTCAAGGCCAGG - Intergenic
1137302259 16:47163013-47163035 GAGCCCAGGAGTTCAAGGCCGGG - Intronic
1139751411 16:69111134-69111156 GGACCCTGGATTTCTAGGCCAGG + Intronic
1203018111 16_KI270728v1_random:370933-370955 GAGCCCAGGAGTTCAAGGCCAGG + Intergenic
1203036446 16_KI270728v1_random:644091-644113 GAGCCCAGGAGTTCAAGGCCAGG + Intergenic
1143003515 17:3811234-3811256 GACACCTGGATGCCAACCCCTGG - Intergenic
1143426153 17:6840185-6840207 GAACCCAGGATTTCAAGACCAGG - Intergenic
1144743333 17:17596600-17596622 GACCCCTGGGTTTAAAATCCTGG + Intergenic
1146200061 17:30849308-30849330 GAGCCCAGGAGTTCAAGGCCAGG - Intronic
1148079647 17:44960561-44960583 GATCCCTGGATTTCTAGGGCAGG + Intronic
1149590579 17:57826949-57826971 GACCCCAGGAGTTCAAGACCAGG + Intergenic
1151241830 17:72764291-72764313 GTCCCTTGGATTTCAAATCCTGG + Intronic
1157012423 18:43666890-43666912 GTCGCCTGGATTTCAGCGCATGG - Intergenic
1157544224 18:48536716-48536738 GACCCCTGGGTTTGAATCCCAGG - Intergenic
1163004439 19:14388750-14388772 GAACCCTGGATTGCAGCGACAGG - Exonic
1163063023 19:14773984-14774006 GAACCCTGGATTGCAGCGACAGG + Exonic
1164532608 19:29059778-29059800 GACCCCACCATCTCAACGCCAGG + Intergenic
1168133177 19:54333821-54333843 GACCCCTGGATGTCCACCCAGGG + Intronic
1168187919 19:54713018-54713040 GACCCCTGGATGTCCACCCAGGG - Intergenic
926985611 2:18619614-18619636 CACCACTGGATTTCAGCACCTGG + Intergenic
927905576 2:26853518-26853540 AACCCCTTGAGTTCAAGGCCTGG - Intronic
934310750 2:91860777-91860799 GAGCCCAGGAGTTCAAGGCCAGG + Intergenic
936099383 2:109561959-109561981 GACCCCAGGAATTCAAGGCCAGG + Intronic
937236582 2:120435014-120435036 GAGCCCGGGAATTCAAAGCCTGG - Intergenic
937573795 2:123394345-123394367 GAGACCAGGATTTCAACCCCTGG - Intergenic
937890775 2:126936890-126936912 GAGCCCTGCATTTCAGAGCCTGG - Intergenic
940750481 2:157621823-157621845 GAACCCTGGATTCTAACTCCAGG - Intronic
941109420 2:161402427-161402449 GAGCCCAGGAGTTCAAGGCCTGG + Intronic
942709304 2:178814719-178814741 GAGCCCAGGAGTTCAACACCAGG + Intronic
945051309 2:205826868-205826890 GACCCCAGGATTCCAATGCCTGG + Intergenic
945079702 2:206076144-206076166 GAGCCCAGGAGTTCAACACCAGG + Intronic
945332421 2:208555395-208555417 GACTCCAGGATTTCAACCCATGG + Intronic
946675895 2:222158829-222158851 GACCCCAGAAGTTCAAAGCCAGG + Intergenic
947609726 2:231516830-231516852 GACCCCAGGAGTTCAAGACCAGG - Intergenic
948329104 2:237151080-237151102 GACTCCTGCATTACAACGACAGG + Intergenic
1175213660 20:57377713-57377735 CACCCCAGGACTTTAACGCCAGG - Intronic
1180537503 22:16406710-16406732 GATCCCAGGAGTTCAAGGCCAGG + Intergenic
1182356106 22:29722857-29722879 GCCCCCTGGATTTCTGCGGCAGG - Intronic
1183071920 22:35402188-35402210 GACCCCAGGAGTTCAAGACCTGG + Intronic
1183129549 22:35821003-35821025 GACTACTAGATTTCAACCCCAGG + Intronic
1183316093 22:37137614-37137636 GACACCTGGAGTTCGAGGCCCGG - Exonic
1184529843 22:45048341-45048363 GAACCCGGGAGTTCAAGGCCAGG - Intergenic
1184614334 22:45627803-45627825 GCCACGTGGATTTCAACGCAAGG + Intergenic
950195411 3:11005873-11005895 AAGCCCTGGATGTCAACCCCTGG - Intronic
950395487 3:12730807-12730829 GACCCCAGGAGTTCAAGACCAGG - Intergenic
954835834 3:53467175-53467197 GAGCCCAGGAGTTCAAGGCCAGG + Intergenic
962522325 3:136208926-136208948 GAGCCCAGGATTTCAAGACCAGG - Intergenic
962864578 3:139437099-139437121 GATCTCTGGATTCCAAAGCCTGG - Intergenic
970713837 4:18896922-18896944 GACACCTGGATTTGAATCCCAGG - Intergenic
973769324 4:54192060-54192082 AACCCCTGGGTTTGAACTCCTGG - Intronic
977943913 4:102888725-102888747 GAGCCCAGGAGTTCAAGGCCAGG + Exonic
992967805 5:82021095-82021117 GACCCCTGAATTTTAAAACCAGG - Intronic
994372047 5:98978464-98978486 GAGCCCAGGAGTTCAACACCAGG - Intergenic
995214429 5:109579145-109579167 GAGCCCAGGAGTTCAAAGCCAGG - Intergenic
996299432 5:121963432-121963454 GTCCCTGGGATTTCAACCCCAGG + Intronic
996785251 5:127230339-127230361 GACACCGGGGTTTCAACACCAGG - Intergenic
998483208 5:142480012-142480034 GTCCCCTACATTTCAACACCTGG + Intergenic
1001033328 5:168278625-168278647 GAAGCCTGGATTTTAATGCCAGG + Intergenic
1002192482 5:177485543-177485565 GATCCCTGGATTTAAACTCAGGG - Intronic
1003743692 6:8974225-8974247 GACACCTGAATTTCAAAGGCAGG + Intergenic
1007832034 6:44646201-44646223 GACCCTTGGGTTTCTATGCCAGG - Intergenic
1008322673 6:50136357-50136379 GTCTCCTGGAATTCAACTCCAGG - Intergenic
1011151922 6:84283536-84283558 GAGCCCAGGAGTTCAAGGCCAGG + Intergenic
1012238332 6:96843700-96843722 CACCCCTGTATTCCCACGCCTGG + Intergenic
1020727802 7:11838209-11838231 GACCCCTTGATTTTAACATCAGG + Intergenic
1022201385 7:28120894-28120916 AACCCCTGGATTTCAAGGCGTGG - Intronic
1023845628 7:44118439-44118461 GACATCTGGATTTCAACTTCTGG + Intronic
1031515875 7:122698047-122698069 GACCCCTGGATTTTACCCCATGG - Exonic
1044094354 8:88044230-88044252 GAGCCCAGGAGTTCAACACCAGG + Intronic
1044622993 8:94209066-94209088 GACCCTTGGATTTCAAAAGCAGG - Intronic
1045292743 8:100847762-100847784 GACTCCTGGAGTACATCGCCAGG + Intergenic
1058742882 9:107961729-107961751 GAGCCCTGGAATTCAAAGCCAGG + Intergenic
1059785142 9:117573948-117573970 GATCCCTGGATTTCATCCGCAGG + Intergenic
1061259697 9:129473049-129473071 GAGGCCAGGATTTCAAGGCCAGG + Intergenic
1185838912 X:3370350-3370372 GAGCCCAGGATTTCAAGACCAGG + Intergenic
1187255809 X:17640897-17640919 CACCCCTGGTTTTCAAAGCAGGG - Intronic
1191740634 X:64432929-64432951 GTGCCCTGGACTTCAACACCTGG + Intergenic
1201236861 Y:11920446-11920468 GAGCCCAGGATTTCAAGACCAGG - Intergenic