ID: 1090776983

View in Genome Browser
Species Human (GRCh38)
Location 11:129974486-129974508
Sequence CAGAATAAGTAGAAGGTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 323}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090776983 Original CRISPR CAGAATAAGTAGAAGGTGAG GGG Intronic
900839880 1:5039928-5039950 CAGAAGGAGAAGAAGGGGAGAGG - Intergenic
902427184 1:16333141-16333163 CAAAATGAATAGAAGGTCAGAGG - Intronic
902690172 1:18106098-18106120 CAGCCTGAGAAGAAGGTGAGGGG + Intergenic
904774092 1:32896090-32896112 CAGGCTAAGCAGCAGGTGAGGGG - Intronic
904957858 1:34301988-34302010 CAAAATAAGTTGAAAGTGAAAGG - Intergenic
904968294 1:34398050-34398072 AAGAAAAAGTTGAAGGAGAGTGG + Intergenic
905531601 1:38683796-38683818 AAGAATAAGAAGAAGCTGGGGGG - Intergenic
906031100 1:42720722-42720744 AAAAATAAAAAGAAGGTGAGAGG + Intergenic
906529049 1:46512704-46512726 CCGAATAGGGAGGAGGTGAGAGG + Exonic
907287385 1:53390536-53390558 CAGAAGGAGGAGAAGGGGAGTGG + Intergenic
908480814 1:64537232-64537254 CAGCATAAGTACTGGGTGAGGGG - Intronic
911991741 1:104706897-104706919 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
912244247 1:107944216-107944238 GAGGGTAAGTAGAAGATGAGAGG - Intronic
912940183 1:114037824-114037846 CAAAATTAGTACAAGTTGAGAGG + Intergenic
914394910 1:147256327-147256349 CTGATTAAGTGGAAGGTCAGTGG - Intronic
914687067 1:149989746-149989768 AAGAAGAAGAAGAAGGTGGGGGG + Intronic
914863632 1:151407114-151407136 CAGAAAAAGGAGAAAGTGGGAGG - Intronic
915401052 1:155622148-155622170 CAGAAAAAGAAAAAGGGGAGGGG - Intergenic
915822582 1:159041091-159041113 CTGAAAAAGTGGTAGGTGAGAGG - Intronic
915877480 1:159627033-159627055 CAAAGTAAGCAGAAGGTGATTGG - Intergenic
916954099 1:169813674-169813696 CAGAAAAAGGAGAAGGTTAGCGG + Intronic
917372567 1:174311358-174311380 CAGACCTAGTAGAAGGTGACTGG - Intronic
917439015 1:175049867-175049889 TAGGAGAAGGAGAAGGTGAGGGG + Intergenic
917872590 1:179255286-179255308 CTCAATAAGTGAAAGGTGAGGGG + Intergenic
918459929 1:184765921-184765943 CTTAATAAGAAGAAGGTGATGGG - Intergenic
918632859 1:186739682-186739704 CAGAATCAGTTGAACCTGAGAGG - Intergenic
920133265 1:203749274-203749296 CAGAATCACTTGAACGTGAGAGG + Intergenic
920267732 1:204736926-204736948 CAGAGTACGTACAAGGCGAGTGG + Intergenic
920377692 1:205518077-205518099 CAGAGTAGGTGTAAGGTGAGGGG - Intronic
920988640 1:210914695-210914717 CAGAAGAACTAGAAGGAGAGAGG + Intronic
924404338 1:243726922-243726944 CTGCCTAAGTAGAAGGTGATTGG - Intronic
1064814676 10:19246166-19246188 CAGATAAAGTAGAGGGAGAGAGG - Intronic
1065414125 10:25466076-25466098 CAGAAAAAGGAAAAGGGGAGGGG + Intronic
1065591673 10:27268682-27268704 CACACTAAGTGGATGGTGAGAGG - Intergenic
1065768442 10:29053912-29053934 GAGAACAAGAAGCAGGTGAGAGG + Intergenic
1065772207 10:29088051-29088073 CAGTAACAGTAGAAGGTGAAGGG - Intergenic
1066718520 10:38312751-38312773 CAAAATAAGTAGAAGGGGGTCGG - Intergenic
1067958173 10:50816685-50816707 CACAATAAGATGAAGGTGAAAGG + Intronic
1069415811 10:68199983-68200005 CAGAATGAGTAGGAGGTGCCAGG - Intronic
1070357478 10:75654560-75654582 TAGAATAAAGAGAAGGAGAGGGG - Intronic
1071396574 10:85229543-85229565 CAAAATAAATTGAAGGTAAGGGG - Intergenic
1071792747 10:88973147-88973169 CAGAAGAAAGGGAAGGTGAGAGG - Intronic
1072847852 10:98852288-98852310 CAGAAAAGGTAGCAGGTGAAAGG - Intronic
1073250821 10:102119578-102119600 CAGGAAAAGTTGAAGGTGGGGGG + Intronic
1074432251 10:113404045-113404067 CAAAGTAGGTAGAAGGTGTGGGG - Intergenic
1077922340 11:6650894-6650916 AAGAATAAATTGTAGGTGAGGGG + Intronic
1078911077 11:15732840-15732862 CATAAAAATTAGAAGGTAAGTGG - Intergenic
1078941823 11:16014934-16014956 CAGAAGATGCAGAGGGTGAGTGG - Exonic
1078976219 11:16480650-16480672 CATAATAAAAAGAAGGTGGGGGG - Intronic
1079603872 11:22342391-22342413 CAGACTAAGCAGGAGTTGAGTGG + Intronic
1083367204 11:62148540-62148562 GAGAAGAAGAAGAAGGTGAGGGG + Exonic
1085679286 11:78556366-78556388 CAGTATAACTAGAAGTTGATGGG - Intronic
1088595000 11:111434886-111434908 CAGGATGAGTGAAAGGTGAGAGG - Intronic
1089484834 11:118837222-118837244 AAGAATAAGAAGAATGAGAGAGG + Intergenic
1090776983 11:129974486-129974508 CAGAATAAGTAGAAGGTGAGGGG + Intronic
1091797449 12:3305419-3305441 CAGAATAGGGAGCAGGGGAGGGG - Intergenic
1097347157 12:58506110-58506132 AATAATAAGAAGAAGATGAGAGG - Intergenic
1097625745 12:61998145-61998167 CAGAGCAAGTAAAAGGAGAGTGG + Intronic
1098150484 12:67541385-67541407 CAGAATAAGCAGAAGGGTATTGG + Intergenic
1098636088 12:72785309-72785331 CAGAATAAGTGGAGAGTAAGAGG + Intergenic
1098885705 12:75958810-75958832 CAGAGCAAGTGGAAGGTCAGAGG - Intergenic
1099568703 12:84285599-84285621 CAGAATAAGTGGCAGGGCAGGGG + Intergenic
1103233664 12:119353572-119353594 AAGAAGAAGAAGAAGGAGAGAGG - Intronic
1104451875 12:128875876-128875898 CAGAGAAAGGAGAAGATGAGGGG - Intronic
1105393456 13:20004698-20004720 CTGGATAAGTAGAAAGTAAGAGG - Intronic
1106544533 13:30718595-30718617 CAGAGAAAGTAATAGGTGAGAGG - Intronic
1106773203 13:32982712-32982734 CGGGATGGGTAGAAGGTGAGGGG + Intergenic
1107163803 13:37262702-37262724 CAGAATCAGGAGGAGGTGAGAGG + Intergenic
1108269860 13:48748953-48748975 CAGAACAAGCAGCAGGTGTGAGG - Intergenic
1108500365 13:51064932-51064954 TATAATCAGTAGAGGGTGAGGGG - Intergenic
1111403636 13:87773010-87773032 CAAAATAAATAAAAGGTAAGTGG + Intergenic
1111782767 13:92750471-92750493 CAGAAAAAGGAGAAAATGAGAGG + Intronic
1113046210 13:106158148-106158170 CAGTGCAAGTAAAAGGTGAGAGG - Intergenic
1114517849 14:23311399-23311421 AAGATTAAGTAGGAGGAGAGGGG + Exonic
1115442734 14:33454742-33454764 CAGAATCAGTAATAGTTGAGCGG - Intronic
1116720425 14:48488842-48488864 CTGAATAAGTGAAAGGTGAAGGG + Intergenic
1118912826 14:70076050-70076072 GAAAAGTAGTAGAAGGTGAGTGG - Intronic
1119266451 14:73265520-73265542 CAGAATAGGAGGAAGGGGAGAGG - Intronic
1119490439 14:75027707-75027729 CAGAATAAGTAGGATGCAAGAGG + Intronic
1120556526 14:85934546-85934568 CAGAAAAAGGAAAAGGGGAGGGG + Intergenic
1122038153 14:98963166-98963188 CAGAAGAAGAAGAAGAAGAGAGG + Intergenic
1125347379 15:38731992-38732014 CAGAATAGGTAGAAGGGAAGTGG - Intergenic
1125519326 15:40339407-40339429 CAGAATAGTTAGTAGGAGAGGGG + Intronic
1126174372 15:45721897-45721919 GAGACGAAGTAGAAGGGGAGAGG + Intergenic
1127202888 15:56676398-56676420 CAGAAAAAGAAAAAGTTGAGTGG - Intronic
1129574555 15:76728298-76728320 CATAATTAGTAAAAGGTTAGAGG - Intronic
1131796945 15:96028851-96028873 CAGAATAAATGGAAGATCAGTGG - Intergenic
1132171454 15:99660946-99660968 CTGAAGAAGAACAAGGTGAGAGG + Intronic
1133177253 16:4024803-4024825 CAGAAGAAGTAAAAGTTTAGGGG + Intronic
1134031594 16:10996424-10996446 TAGCAGAAGTAAAAGGTGAGTGG + Intronic
1134105872 16:11485707-11485729 AAGAATAGATAGAAGGAGAGGGG - Intronic
1134803542 16:17106680-17106702 CAGAAAACGTGGAGGGTGAGTGG - Exonic
1135658276 16:24270852-24270874 CAAAATATGAAGCAGGTGAGAGG + Intronic
1135824832 16:25717488-25717510 AAGGATGAGTAGAAGGTGAAGGG + Intronic
1136016977 16:27406595-27406617 CAGTAGAAGACGAAGGTGAGAGG - Intronic
1139293228 16:65876652-65876674 CAGAATAACTGGGAGGAGAGTGG + Intergenic
1140016108 16:71187304-71187326 CAGAATAAATACAAGGTTACAGG + Intronic
1140413428 16:74755713-74755735 AAGAAAAAGTAGAATGTGAATGG - Intronic
1142799370 17:2336029-2336051 CAGAAGAAGGAGGCGGTGAGAGG - Exonic
1143502233 17:7346281-7346303 CAGAAGAAGTACAAGGTGAGTGG + Exonic
1143594850 17:7907891-7907913 CAGAAGATGTAAAAGGTGACCGG + Exonic
1148252214 17:46093213-46093235 AAGAATAACTAGGAGGTGACTGG - Intronic
1148368913 17:47079448-47079470 AAGAATAACTAGGAGGTGACTGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149958823 17:61084166-61084188 TACAATAAGTAGAATGGGAGAGG - Intronic
1150668212 17:67165314-67165336 CAGAAGAAATGGAATGTGAGGGG + Intronic
1150671010 17:67197279-67197301 CACAATCAGCAGAAGGTGAAAGG - Intronic
1150889892 17:69135653-69135675 CAGAATGAATAGCAGGTGTGAGG - Intronic
1151160781 17:72163702-72163724 CAGGATAAGCTGAAGGTGGGTGG - Intergenic
1151171665 17:72251590-72251612 CAAAATAAGTAGGGAGTGAGGGG - Intergenic
1153434311 18:5052658-5052680 CAGAATCAGTAGGATGTGTGTGG - Intergenic
1153872433 18:9333907-9333929 CAGCCTAGGTAGAAGGTGCGCGG - Intergenic
1156198544 18:34804065-34804087 CATAATAAGTAAAAAGTGAAGGG + Intronic
1156228333 18:35130557-35130579 CAGAATTATTAGAAGGAGAGAGG + Intronic
1156370357 18:36467243-36467265 CAGAATTACTAGGAGGTGACTGG - Intronic
1157305128 18:46511473-46511495 CAGAATAGGAAGGACGTGAGGGG - Intronic
1157411059 18:47463948-47463970 CAGAATCAGGAGAGGGAGAGTGG - Intergenic
1158035274 18:53021055-53021077 AGAAATCAGTAGAAGGTGAGAGG - Intronic
1159522679 18:69546409-69546431 CAGCAGAGGTAGAAAGTGAGAGG - Intronic
1160349761 18:78166713-78166735 CAGTATATGTAGATGGAGAGGGG + Intergenic
1160692083 19:464812-464834 CAGGATAGGTAGGAGGTGAGTGG + Intronic
1161351807 19:3797240-3797262 AAGAAAAAGTAGAAAGTGGGGGG - Intronic
1161366940 19:3885564-3885586 AAGAAGAAGGAGAAGGAGAGAGG + Intronic
1167241659 19:48347300-48347322 CTGAATTAGTGGAAGGAGAGAGG + Intronic
925515087 2:4673221-4673243 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
927587383 2:24319812-24319834 CAGAAGAAGTAGAAGATCAAGGG - Intronic
927920117 2:26965731-26965753 CAAAAGGAGTAGAAGGTGAAGGG + Intergenic
928187889 2:29130734-29130756 CAGCATAACTAAAAGATGAGAGG - Intronic
928902018 2:36329664-36329686 CAGAAGATGTAGAAGGACAGGGG - Intergenic
928930669 2:36620529-36620551 CAGAAGAAGGAGAAGCTGAAAGG - Intronic
929092066 2:38228646-38228668 CAGAAGAAGAATAAGGTAAGAGG + Intergenic
929518677 2:42627527-42627549 CATAATAAAGAGAATGTGAGGGG - Intronic
929816084 2:45232789-45232811 CATTATATGTGGAAGGTGAGAGG + Intergenic
930250931 2:49033469-49033491 GAGAATAAGTAGTAGCTGAAAGG + Intronic
930675650 2:54197718-54197740 AGGAATAAGTAGAAGGCTAGTGG + Intronic
930955668 2:57199420-57199442 GAGAGTGAGAAGAAGGTGAGGGG + Intergenic
931361331 2:61580385-61580407 CAGAATAATTATAAGGTCAAAGG - Intergenic
931498886 2:62841842-62841864 AAGACAAGGTAGAAGGTGAGTGG - Intronic
931750977 2:65329644-65329666 TAGAATCAGAAGAGGGTGAGAGG - Intronic
933900899 2:86849360-86849382 GAGAACAAATAGGAGGTGAGAGG - Intronic
934696472 2:96404193-96404215 CAGAATGAGTAGCAGGGAAGTGG + Intergenic
934916350 2:98303970-98303992 ATGAATAAGTAGCAGGTGAAAGG - Intronic
935195283 2:100810274-100810296 CAAAAGAAGAAGAAGGGGAGCGG + Intergenic
935661373 2:105469544-105469566 CAGAAGGAGGAGAAGGTTAGAGG - Intergenic
935779643 2:106499871-106499893 GAGAACAAATAGGAGGTGAGAGG + Intergenic
936664215 2:114575872-114575894 CAGAATAAGTGGAGGGGGTGGGG - Intronic
940044838 2:149398768-149398790 AATAATAAGCAGAAGGTAAGTGG + Intronic
941161987 2:162045988-162046010 CAGACAGAGTGGAAGGTGAGAGG + Intronic
941833565 2:169990992-169991014 CACAATAAGTTGAAAGTGAAAGG + Intronic
942529731 2:176896786-176896808 CAGAAATAGTTTAAGGTGAGTGG - Intergenic
942950505 2:181715859-181715881 TAGAATAATTACAAGCTGAGAGG - Intergenic
942977786 2:182039800-182039822 CAGAATTGGGAGAGGGTGAGGGG - Intronic
944566351 2:200995444-200995466 CAGAATAAGGCAAAGGTGATGGG + Intronic
945393211 2:209290176-209290198 CAGAATAAATAAAATGTCAGAGG - Intergenic
945582377 2:211611312-211611334 CAGAAAAAGGAAAAGGGGAGGGG + Intronic
945657884 2:212647500-212647522 AAGGGTAAGTGGAAGGTGAGTGG + Intergenic
945698706 2:213142719-213142741 CAGAAGCAGTAGACTGTGAGTGG - Intronic
945962061 2:216146000-216146022 CATAATAAGAAGGTGGTGAGGGG + Intronic
946414783 2:219534528-219534550 CAGCAGAAACAGAAGGTGAGAGG - Intronic
947011146 2:225568380-225568402 CAAAATAAATAAAAGGAGAGTGG - Intronic
948236122 2:236391968-236391990 AAGAAAAAGGACAAGGTGAGTGG - Exonic
1169800905 20:9510411-9510433 CTAAATAAGTAAATGGTGAGGGG - Intergenic
1170037249 20:12002587-12002609 CAGCATAAGTAGCAGGTGTATGG + Intergenic
1170473153 20:16688325-16688347 AAGAATCTGCAGAAGGTGAGAGG + Intergenic
1170497940 20:16944909-16944931 AAGAACAATTAGATGGTGAGGGG - Intergenic
1170612644 20:17927307-17927329 CAGAATAGGTGGAAGGTTTGAGG + Intergenic
1171188169 20:23138226-23138248 AAGAACAAATAGAAGGTCAGAGG - Intergenic
1171333810 20:24364869-24364891 CAGAATATGAAGAAGGACAGTGG - Intergenic
1172572928 20:35984441-35984463 CAGATTAAGAAGAAGGGGAGTGG + Intronic
1173108307 20:40159610-40159632 AAGAATTAGTAGAATGTGAAAGG + Intergenic
1173866575 20:46316388-46316410 CAGAATAAATAGAATGTCAGAGG + Intergenic
1173891504 20:46514918-46514940 CAGGAGAAGTAGGAAGTGAGAGG + Intergenic
1175691897 20:61071521-61071543 CTGAGTAAGTGGAGGGTGAGAGG + Intergenic
1177316356 21:19466758-19466780 CTGAATAGGTAGCAGGTGTGTGG + Intergenic
1178058962 21:28830905-28830927 CAGAAAGAATAGAAGGTGAAAGG + Intergenic
1178470864 21:32891524-32891546 CAATGGAAGTAGAAGGTGAGGGG - Intergenic
1178786224 21:35656268-35656290 CAGAGTAACTTCAAGGTGAGGGG - Intronic
1181776221 22:25161751-25161773 CAGGAAAAGGAGAAGGGGAGGGG - Intronic
1181817284 22:25448104-25448126 CAGAATGAGAAGAAGGAAAGCGG + Intergenic
1182041181 22:27240014-27240036 CTTAATCAGAAGAAGGTGAGAGG - Intergenic
1182401777 22:30083593-30083615 CAGAATAATTAGAGGCTGAAAGG + Intronic
949929110 3:9064388-9064410 AAGATGAAGGAGAAGGTGAGTGG - Exonic
951274312 3:20666461-20666483 CAGGGTGAGTAGAAGGTGAGAGG + Intergenic
951358778 3:21701061-21701083 CAGAATGAGTATAAGTTGGGAGG + Intronic
951497537 3:23347766-23347788 CAGAAGTAGTAGTTGGTGAGAGG - Intronic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
952593439 3:34986289-34986311 CAGATTCAGTGAAAGGTGAGGGG - Intergenic
952747056 3:36791368-36791390 CAGAATCAGCAGAAGAGGAGTGG - Intergenic
957016734 3:75073321-75073343 CAATATATGTAGAATGTGAGAGG - Intergenic
957303164 3:78420038-78420060 AAGAAAAAGTAGCAGGTGAAAGG + Intergenic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
957579318 3:82050374-82050396 GAGAATAATTAGAAGCAGAGGGG + Intergenic
958988316 3:100809948-100809970 CTGAATAACTACAAGGTGACTGG + Intronic
960540064 3:118851904-118851926 CAGAAAAAGGAAAAGGGGAGGGG + Intergenic
960707810 3:120497381-120497403 CAGAAAAGGGGGAAGGTGAGTGG - Intergenic
961603502 3:128077368-128077390 CAGAACAAATGGAAGGGGAGTGG + Intronic
962055307 3:131865400-131865422 CACAAAAAGTAGGAGGTGAAGGG - Intronic
963893519 3:150661301-150661323 CACAAAAAGGAAAAGGTGAGGGG - Intronic
964073357 3:152663239-152663261 CAGAACAAAGAGAAGGTAAGAGG + Intergenic
964949981 3:162278363-162278385 GAGAATAAGTAATATGTGAGTGG + Intergenic
965706589 3:171514546-171514568 TAGAAATAGTTGAAGGTGAGTGG + Intergenic
966242288 3:177768223-177768245 GACAGAAAGTAGAAGGTGAGTGG + Intergenic
966470343 3:180282084-180282106 CAGCAGAAGTAGTAGCTGAGGGG + Intergenic
967540813 3:190665556-190665578 AAGAATATTTAAAAGGTGAGAGG + Intergenic
969506454 4:7591184-7591206 GAGAAGAAGGAGAAGGTGGGAGG - Intronic
970466239 4:16325855-16325877 CAGAAAAAGCAGAAGCAGAGAGG + Intergenic
971181404 4:24331409-24331431 CAGGATAAGGAGATGGTGAGTGG - Intergenic
971286461 4:25294763-25294785 CAGCCCAAGTAGAAGGGGAGTGG - Intergenic
971351273 4:25858208-25858230 CAGAAGAAATAGAAGGCAAGAGG + Intronic
973240236 4:47948900-47948922 TAGAATGAGTAGAAGCGGAGAGG + Intronic
974525564 4:63046110-63046132 CAGAAAAAGTAGAAAGAGATGGG - Intergenic
975382125 4:73713078-73713100 AAGAATAGCTAGAAGGAGAGAGG + Intergenic
978249944 4:106618679-106618701 AAGCATGAGTAGAAGATGAGAGG + Intergenic
979294153 4:119011607-119011629 AAGAATAAATAGAAAGTAAGAGG + Intronic
981172724 4:141643569-141643591 GAAAATAAGGAGAAGGGGAGTGG - Intronic
982129202 4:152212171-152212193 CCAAATAAGTAGGGGGTGAGGGG + Intergenic
982296669 4:153836044-153836066 CACAAGAAGTTGAAGGTGGGAGG - Intergenic
983100804 4:163623467-163623489 AATAAAAAGTAGAAGGTAAGTGG - Intronic
984270959 4:177548290-177548312 CTGAATATGTGGAAGCTGAGAGG + Intergenic
985927512 5:3029478-3029500 CAGAAGAAGCAGAAGATGTGGGG + Intergenic
986140542 5:5025963-5025985 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
987503954 5:18746306-18746328 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
987783536 5:22469070-22469092 CAGAATATTTTGAGGGTGAGGGG + Intronic
988359694 5:30219922-30219944 CAGAACAAGTAGAGACTGAGGGG - Intergenic
989090348 5:37723968-37723990 CAGTATAGGTAGAAGGTAGGAGG + Intronic
989122081 5:38015003-38015025 CAGTATATGTAGGAAGTGAGAGG - Intergenic
989573198 5:42964539-42964561 CACAAGAAATAGAAAGTGAGAGG - Intergenic
990222166 5:53604867-53604889 AAGAATAGGTAGATGGTGACCGG - Intronic
991651692 5:68862216-68862238 CAGAATGAGTAGAGGCAGAGAGG + Intergenic
992618112 5:78565077-78565099 CAGAAAAAGTAAAAGGCCAGGGG + Intronic
994383002 5:99094020-99094042 TGGAATATGTAGAAGATGAGAGG + Intergenic
994739348 5:103598475-103598497 AAAATTAACTAGAAGGTGAGAGG - Intergenic
995174788 5:109163391-109163413 GAAAATATCTAGAAGGTGAGTGG + Intronic
995714495 5:115068784-115068806 CAGAAAAAGGAGAAGAGGAGGGG - Intergenic
997221093 5:132165084-132165106 CAGAATAAGTAGGTGGTGGCGGG - Intergenic
997682498 5:135766132-135766154 CATAATATCTAGAAGGGGAGAGG + Intergenic
998893185 5:146768533-146768555 CAAAATAAGCAGGAGGTGAATGG - Intronic
1000019249 5:157304409-157304431 TTTAATAAGAAGAAGGTGAGAGG - Intronic
1000893044 5:166821808-166821830 AAGGATAAGTAGAAGTTCAGTGG - Intergenic
1001158800 5:169296452-169296474 CAGACTAAGGAGCAGCTGAGTGG - Intronic
1001201391 5:169720818-169720840 GAGAATCAGTTGAAGGTGGGAGG - Intronic
1001383392 5:171318407-171318429 GAGACTAAGAAGAAGGGGAGGGG + Intergenic
1002114433 5:176947492-176947514 TAAAAGAAGTAGAAGGCGAGCGG - Intronic
1002660061 5:180785725-180785747 CAGGATCAGGAGTAGGTGAGCGG - Intergenic
1003242352 6:4355610-4355632 CAGAATGTGTGGAAAGTGAGAGG + Intergenic
1003904836 6:10689608-10689630 CAGAACTAGTAGAAGGGGATAGG + Intronic
1006745507 6:36339207-36339229 CACAATAAAAAGAAGGGGAGGGG + Intergenic
1007002368 6:38326176-38326198 AAGGATAAGGAGAGGGTGAGGGG + Intronic
1007004556 6:38348210-38348232 CAGAAAAAGCAGAAAGAGAGAGG - Intronic
1007044843 6:38762576-38762598 CAGAATAAATGGAGGGTGGGGGG + Intronic
1007272130 6:40645887-40645909 CAGCACATGTAGAAGGGGAGGGG + Intergenic
1008135289 6:47769253-47769275 CAGAATATGAAGAAAGTGAGAGG - Intergenic
1008339958 6:50352823-50352845 CAGAACAAGAAGGAGGCGAGAGG + Intergenic
1008408657 6:51147521-51147543 AAGAATATCTAGAAGCTGAGGGG + Intergenic
1009398168 6:63226964-63226986 AAGAATAAGAAATAGGTGAGGGG + Intergenic
1009520921 6:64681405-64681427 AAGAATAACTAAAAGATGAGGGG + Intronic
1010254110 6:73738504-73738526 CAGAATAAGTACCAGAAGAGAGG + Intronic
1011407045 6:87026489-87026511 AAGAAGAAGAAGAAAGTGAGGGG + Intergenic
1013821366 6:114157082-114157104 CAGAAGGAAGAGAAGGTGAGGGG - Intronic
1014298078 6:119644767-119644789 CAGTACAAGTAGAAGGAAAGTGG - Intergenic
1014503097 6:122217780-122217802 CTGAAAAAGTAGAAAGTGAATGG - Intergenic
1015233727 6:130946615-130946637 CATAAAAAGTAGAGGATGAGGGG + Intronic
1015436472 6:133195378-133195400 CTGAAAAAGTGGAAGGTGGGAGG + Intergenic
1017845647 6:158255721-158255743 CAGAACAAGTCCAAGGTTAGTGG - Intronic
1018000587 6:159575209-159575231 AAGAATATGTAGAAAGTTAGGGG - Intergenic
1018276332 6:162135711-162135733 CAGAGAAGGTAGAAGGTGAAAGG + Intronic
1019209801 6:170395626-170395648 CAGCAAAAGCACAAGGTGAGAGG - Intronic
1020361516 7:7331579-7331601 CAGAATTAGAAGGAGGTGAGAGG + Intergenic
1021158857 7:17246846-17246868 GAGAAAAAGGAGAAGGTGAAAGG - Intergenic
1022648956 7:32257578-32257600 CAGAATAATTACAAGGTGCCAGG - Intronic
1024369862 7:48569612-48569634 GAGAATCACTAGAACGTGAGAGG - Intronic
1026766711 7:73164701-73164723 CAGCAAAGGTAGAGGGTGAGAGG + Intergenic
1027043188 7:74974400-74974422 CAGCAAAGGTAGAGGGTGAGAGG + Intronic
1027080458 7:75227959-75227981 CAGCAAAGGTAGAGGGTGAGAGG - Intergenic
1028271858 7:88801267-88801289 CAGAACTGCTAGAAGGTGAGTGG + Intronic
1028406067 7:90475280-90475302 CAGAATAAGTGCAGGGTCAGAGG + Intronic
1028735350 7:94205269-94205291 CAGTATGATTAGAAGGTGAGAGG - Intergenic
1029258481 7:99285401-99285423 AAGAAGAACTAGAAGCTGAGAGG + Intergenic
1029389663 7:100266574-100266596 CAGCAAAGGTAGAGGGTGAGAGG - Intronic
1030014391 7:105204075-105204097 CAGAATTGGTAGGAGTTGAGTGG - Intronic
1031656092 7:124357659-124357681 CAGAACAAGAAGAAGATGAAGGG - Intergenic
1032656243 7:133933577-133933599 CATAATAAGCAGAAGATGAAGGG + Intronic
1032784342 7:135188619-135188641 CAGCCTGAGTAGAGGGTGAGGGG - Intronic
1033765854 7:144489487-144489509 CAAAACCCGTAGAAGGTGAGTGG - Intronic
1038995353 8:32916850-32916872 CAGAATTAATAGAAAGTGAAGGG + Intergenic
1039827001 8:41183149-41183171 CAGAAAAAGCAGAAGATGAGTGG - Intergenic
1040597656 8:48855424-48855446 CAGAAACAGTAGAATTTGAGTGG + Intergenic
1040911066 8:52519709-52519731 CAGAGTAAGTAGCAGGAGATGGG - Intergenic
1041417574 8:57628877-57628899 CAGGATAAGCAGAAGGGAAGAGG - Intergenic
1041930517 8:63281249-63281271 CAGAATAAGAGGAAGATGATGGG - Intergenic
1042171838 8:65999198-65999220 TAGAATAAGGAGAAAGTGGGAGG - Intergenic
1043226569 8:77739752-77739774 CAGCATAAGTATAAGCTGAAAGG - Intergenic
1043457799 8:80429585-80429607 CAAAATAAGTAGAATGGGTGGGG + Intergenic
1045132684 8:99174242-99174264 CACAATAGCTAAAAGGTGAGAGG - Intronic
1045288848 8:100814583-100814605 CACACTAAGTAGAAGGTTATAGG - Intergenic
1045331473 8:101159187-101159209 GAGAACAAGTAAAAGCTGAGGGG + Intergenic
1046365728 8:113228645-113228667 CAGAATATGTGGGAGGTGGGAGG - Intronic
1047723436 8:127664176-127664198 CATAACAAGTAGCAGGAGAGAGG + Intergenic
1048397001 8:134023295-134023317 CAGAATAAATGGAAGATGAGTGG + Intergenic
1048732594 8:137460455-137460477 CTGCATAGGTAGAAGTTGAGTGG + Intergenic
1050874309 9:10615049-10615071 CAGAAGCAGTAGAAAGGGAGAGG - Intergenic
1051141003 9:13978870-13978892 AAGAAAAAGAAGAAGGGGAGTGG - Intergenic
1051347474 9:16165263-16165285 CAGAATGAGTATGAGCTGAGAGG + Intergenic
1051391700 9:16572262-16572284 CAAAATAAGTGAAAGGTAAGTGG - Intronic
1052367549 9:27630002-27630024 CAGAAGAAGTAACAAGTGAGCGG + Intergenic
1052560166 9:30075328-30075350 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
1053375212 9:37600374-37600396 CAGAATAAATAGGAGGTGGCCGG - Intronic
1055928835 9:81539013-81539035 CTGAATCAGCAGAAGGTGGGAGG + Intergenic
1056160566 9:83887533-83887555 CAGTAAAAGTAGAAGTTGATAGG - Intronic
1056459648 9:86797362-86797384 AAGAACAAGTAGAAGTTCAGAGG - Intergenic
1058170960 9:101680729-101680751 CAGAAGGAATAGAAGGTAAGAGG - Intronic
1058361779 9:104155814-104155836 CAGATTAAGCAGAAGGTCAAAGG - Intergenic
1058438076 9:104982202-104982224 CAGAATCAGGAGAAGGTTAGTGG + Intergenic
1060763434 9:126275303-126275325 CAGAATAAAGAGAAGAGGAGAGG - Intergenic
1061731423 9:132617315-132617337 TGGAATAAGTAGAAGGAGATGGG - Intronic
1062297064 9:135836573-135836595 CAGAATGGGTAGAAAGTGTGTGG - Intronic
1062455515 9:136635517-136635539 CAGAATAAATATAAGGTCACTGG - Intergenic
1186997917 X:15143374-15143396 CAGAATAAGAAGGCAGTGAGGGG - Intergenic
1187028895 X:15465305-15465327 TATAATAAGTAAAAGGTCAGTGG - Intronic
1187095712 X:16145862-16145884 CATAATAAGCAGAAAATGAGAGG + Intronic
1187172627 X:16867132-16867154 CAGCATAAGTACACGGTAAGTGG - Intronic
1187377060 X:18764510-18764532 CTGAATAAGTTGAAGGTGGAAGG + Intronic
1189791087 X:44605637-44605659 CAGAAGAAATAGAAGATGTGAGG - Intergenic
1190577980 X:51860537-51860559 CAGAATAAGGAGCAGGTTTGTGG + Intronic
1192179625 X:68908398-68908420 AAGATGAAGTAGAAGGGGAGAGG + Intergenic
1193066523 X:77265791-77265813 CAGGAGAAGGAGAAGGTGAAGGG - Intergenic
1193199258 X:78668390-78668412 CAGAATAGATAGAGGGTGAGTGG - Intergenic
1193443541 X:81571395-81571417 CAAAATTAGTAGAAGGAAAGGGG + Intergenic
1194376644 X:93142839-93142861 CAGAAGAAAGAGAGGGTGAGGGG - Intergenic
1194585217 X:95724522-95724544 CAGAACAAGAAGAAATTGAGAGG - Intergenic
1195118442 X:101723799-101723821 CAGAAGGAATGGAAGGTGAGAGG - Intergenic
1195219695 X:102734525-102734547 CAGAATCAGTAGAACCTGAGAGG + Intronic
1196852653 X:119952629-119952651 AAGAATAAGAATAAAGTGAGAGG - Intergenic
1196961273 X:121004739-121004761 AAGAATAAAGAGAAGGTTAGAGG + Intergenic
1197535222 X:127679030-127679052 TAGAGGAAGTAGAAGGAGAGTGG + Intergenic
1198013258 X:132581767-132581789 CAAAGTAAGTAGAAGGTGAAAGG - Intergenic
1198588144 X:138145786-138145808 CAGAATAAGTAGAGGAAGAGAGG - Intergenic
1199329687 X:146544105-146544127 CAGAATGAGAGCAAGGTGAGGGG + Intergenic
1199619730 X:149688372-149688394 GAGAAAAAGAAGAAGGTGAAAGG + Intronic
1199716338 X:150509567-150509589 CAGAGTATGTAGAAGGAGGGAGG - Intronic
1199761668 X:150909283-150909305 CAGGATGAGAAGGAGGTGAGGGG + Intergenic
1199940009 X:152616014-152616036 CAGAATAACTAGGAGGTCAGTGG + Intergenic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200711514 Y:6488745-6488767 CATCATAAGTGGAAGGAGAGGGG + Intergenic
1201022418 Y:9673242-9673264 CAACATAAGTGGAAGGAGAGGGG - Intergenic
1201939316 Y:19442398-19442420 AAGAATAGCTACAAGGTGAGTGG - Intergenic
1202106112 Y:21367861-21367883 CAGAATCAGTTGAAGATGGGAGG + Intergenic