ID: 1090777127

View in Genome Browser
Species Human (GRCh38)
Location 11:129975544-129975566
Sequence CCCACCATGGGGGAGTGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 1, 2: 2, 3: 26, 4: 327}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090777127_1090777137 -7 Left 1090777127 11:129975544-129975566 CCATCCCACTCCCCCATGGTGGG 0: 1
1: 1
2: 2
3: 26
4: 327
Right 1090777137 11:129975560-129975582 TGGTGGGAATGGGACTTCACTGG 0: 1
1: 0
2: 0
3: 20
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090777127 Original CRISPR CCCACCATGGGGGAGTGGGA TGG (reversed) Intronic
903270479 1:22185309-22185331 CACACCTTGGGGGAAAGGGAGGG - Intergenic
903325188 1:22565285-22565307 CCCAGCATGGAGGAGAGGCACGG + Intronic
904272440 1:29359009-29359031 CCCAGCATGGGCAACTGGGATGG + Intergenic
904438500 1:30514794-30514816 CCCACCCTGTGTGTGTGGGACGG + Intergenic
904490653 1:30857034-30857056 TCCACCACTGGGGAGTGGTAAGG - Intergenic
904659789 1:32075805-32075827 CCTACCAGGGAGGTGTGGGAGGG - Exonic
905656105 1:39687028-39687050 CCCAGCAAAGGGGAGTGGGAAGG - Intronic
905873089 1:41416129-41416151 CCCACCAGGGCTGAGTGGGGCGG + Intergenic
905925870 1:41749287-41749309 CCCACCCAGGGGAAGTGAGAGGG - Intronic
906048627 1:42852383-42852405 ACAAACATGGGGGAGTGTGAAGG - Exonic
906537572 1:46560164-46560186 GCCACCATGGGGGTGGGGGCCGG - Intronic
906581802 1:46941207-46941229 AACTCAATGGGGGAGTGGGAGGG - Intronic
907425786 1:54378609-54378631 GCCACCATTGGGGGCTGGGACGG + Intronic
907954737 1:59217328-59217350 CCCACCATGGCAGAGTGGCCTGG - Intergenic
909481459 1:76132032-76132054 CCCACAAGGGAGGAGTGGAATGG - Intronic
910239945 1:85075536-85075558 CCCACCATGAGGAAGTCAGAGGG - Intronic
910712650 1:90197557-90197579 CCTTCCATGGGGAAGGGGGATGG + Intergenic
911769844 1:101726386-101726408 GCCACCAACAGGGAGTGGGATGG - Intergenic
912162894 1:107007711-107007733 CCCAGCAAGATGGAGTGGGATGG - Intergenic
912379570 1:109240140-109240162 CCCTCCCTGAGGCAGTGGGATGG + Intergenic
912746131 1:112247180-112247202 CCCACCCTGGGGGATTGGAGGGG - Intergenic
912777821 1:112517104-112517126 CACAGCCTGGGGGAGGGGGAAGG - Exonic
912955512 1:114152490-114152512 CCCTCCATGGGGGAGGGGCTGGG - Intronic
914815827 1:151061302-151061324 GCCACCATGGGGAAGGGGGAAGG - Intronic
915123941 1:153650167-153650189 CCTGCCATGGGTGAGTGGGGAGG + Intergenic
915194371 1:154178429-154178451 CCCTCCAGGGTGGAGTGGTAGGG + Intronic
915285289 1:154848348-154848370 CCCAGCTCGGGGCAGTGGGAAGG - Intronic
915908013 1:159893382-159893404 CCCATGCTGGGGGAGTGGGTGGG + Intronic
916887640 1:169085789-169085811 CCCACCCAGGGGGAGTGAGTGGG - Intergenic
920679415 1:208060898-208060920 ACCTCCCTGGGGGAGGGGGAAGG - Intronic
920697429 1:208191983-208192005 CCCACCATGAGGCAAGGGGAGGG - Intronic
920968909 1:210725736-210725758 CTCAGCACGGGGGACTGGGAAGG - Intronic
921160338 1:212467985-212468007 CCCAGCAAGGAGGAGAGGGATGG - Intergenic
922790319 1:228307570-228307592 GCAACCATAAGGGAGTGGGATGG - Intronic
922898634 1:229119505-229119527 TCCACAATGTGGGAGTGGGCTGG - Intergenic
924083231 1:240420961-240420983 ACCTCCATGGAGGAGAGGGAAGG + Intronic
1063205355 10:3826077-3826099 CACGTCATGGAGGAGTGGGAGGG - Intergenic
1067431589 10:46249288-46249310 CCCAGCATGGGGGCCTGGGCAGG + Intergenic
1067441831 10:46312886-46312908 CCCAGCATGGGGGCCTGGGCAGG - Intronic
1067776779 10:49170032-49170054 CCCACCAAGGGAGGATGGGAGGG - Intronic
1068653768 10:59553611-59553633 CCCAGCAGAGGGGAGTAGGAAGG + Intergenic
1068947770 10:62746763-62746785 CCCACAATGGGGCAGAGGGTTGG - Intergenic
1069131506 10:64709544-64709566 ACCAAGGTGGGGGAGTGGGAGGG - Intergenic
1069132633 10:64726220-64726242 CGCACCATGGGTGAGATGGAGGG - Intergenic
1069569273 10:69484699-69484721 CCCACAGTGGGTGAGGGGGATGG - Intronic
1069793975 10:71040768-71040790 CCCTACATGGGGGTGTGGGGGGG + Intergenic
1070780980 10:79137486-79137508 CATACCGAGGGGGAGTGGGAAGG - Intronic
1070830195 10:79413396-79413418 CCCGTCCTGGGGGAGTGGAACGG + Intronic
1070972489 10:80578996-80579018 CCCACCATGGGGAGCTGGGGAGG + Intronic
1073024707 10:100479371-100479393 CCCACCACGGGGCACTGAGAAGG - Intronic
1073449812 10:103602699-103602721 CCCACCAAGAAGGAATGGGAAGG - Exonic
1075630966 10:124000391-124000413 ACCACCATGCGGGAGTGGTGCGG + Intergenic
1076103617 10:127802784-127802806 TGCACCCTGAGGGAGTGGGATGG - Intergenic
1076495484 10:130894731-130894753 CCCACACTCGGGGAGGGGGATGG - Intergenic
1077009189 11:372727-372749 CCCGCCATGGGGGTGTCTGATGG - Exonic
1077162266 11:1119230-1119252 CCCAACATGGGGTACGGGGAGGG - Intergenic
1077183444 11:1226423-1226445 GCCACCCTGGGGGATGGGGACGG + Intronic
1078222613 11:9364310-9364332 GCCCCCGTGGGGCAGTGGGAAGG + Intergenic
1082618074 11:55386624-55386646 CCCACCATGGGGGAGAGATCTGG - Intergenic
1083767499 11:64848880-64848902 CCCAGCATGAGGAAGTGGCAGGG + Intergenic
1084215663 11:67645645-67645667 CTCCCCAGAGGGGAGTGGGAGGG - Intronic
1084411116 11:69006329-69006351 CCCAGCGTGGGGGAGGGGGGGGG + Intronic
1084797665 11:71519147-71519169 CCCACCGTGAGGGGATGGGAGGG - Intronic
1084883640 11:72189542-72189564 GCCTCCATGGGGTAGTGGGAGGG - Intronic
1085518115 11:77123007-77123029 CCCCCCACGGGGAAATGGGAGGG - Intronic
1086143247 11:83522047-83522069 CACACAATGGGGCAGTGGTAAGG - Intronic
1086315699 11:85589541-85589563 GCCACTGTGGGGGTGTGGGAGGG + Intronic
1086414035 11:86570862-86570884 GCCAGCATGGGGGAGTGGGAAGG + Intronic
1088704370 11:112448226-112448248 CACTCCATGAGGGAGTGGGCAGG - Intergenic
1088897744 11:114090950-114090972 CCCACCTTAGGGCAGGGGGAAGG - Intronic
1089556941 11:119320222-119320244 ACCACCATGGGAGAGAGGGAGGG + Intronic
1089730839 11:120517756-120517778 GCCCCCAGGAGGGAGTGGGAAGG + Intronic
1089777888 11:120851700-120851722 CCCACAGTGGGGGCGGGGGAGGG - Intronic
1089949282 11:122510236-122510258 CCCAGGATGGTGGCGTGGGAGGG + Intergenic
1090073978 11:123567711-123567733 GGCAGCAGGGGGGAGTGGGATGG + Intronic
1090201659 11:124861965-124861987 CACACCAGTGGGGGGTGGGATGG + Intergenic
1090777127 11:129975544-129975566 CCCACCATGGGGGAGTGGGATGG - Intronic
1091389521 12:117571-117593 CCCACCTTGAGGGAGTGGCCGGG + Intronic
1091595043 12:1872584-1872606 CCGACCATGGGGCGGTTGGATGG + Intronic
1091952541 12:4606962-4606984 CCCACCATGGAGCACTGGAAAGG - Intronic
1092265280 12:6976265-6976287 CCCCCCATGGGGGGGTGGAGAGG - Exonic
1092377919 12:7970862-7970884 CCCAGCATGTGGGAGTCGGCGGG - Intergenic
1094723145 12:33085727-33085749 ACCCCCATGTGGGAGTGGGAAGG + Intergenic
1096601728 12:52734539-52734561 CCCACCCTGTGGGACTGGAAGGG - Intergenic
1099211321 12:79792692-79792714 CCCACCAGGCTGGAGTGGAAGGG - Intronic
1101514071 12:105418503-105418525 CCCACCCAGATGGAGTGGGAAGG + Intergenic
1102532259 12:113555194-113555216 TCCAAAATGGGGGAGGGGGAAGG + Intergenic
1102571306 12:113828647-113828669 CCCACCCTTGGGGAGTATGAGGG + Intronic
1103259781 12:119576720-119576742 CAAACAATGGGGGAGTGGGGAGG + Intergenic
1104731086 12:131105693-131105715 CCCAGCCTGGGGGACTGGGTCGG + Intronic
1106802628 13:33271676-33271698 CCCTCAAGAGGGGAGTGGGAGGG + Intronic
1107621170 13:42232143-42232165 CACAGCTTTGGGGAGTGGGATGG + Intronic
1109047925 13:57437560-57437582 ACCACCAGGGTGGAGAGGGAAGG + Intergenic
1111002966 13:82208659-82208681 CCCACCATGGTGGAGGAGGAGGG - Intergenic
1113662585 13:112117584-112117606 TCCACCATGGGGCAGTGTGCCGG + Intergenic
1114538547 14:23438169-23438191 CCCACCATGCTGGGGTGGGTGGG + Intergenic
1114591617 14:23870015-23870037 CCCACCAAGGGGCAGTGGGTGGG + Intergenic
1117183153 14:53213119-53213141 CCCACCATGGGGGGGAGGGTGGG + Intergenic
1117744944 14:58860207-58860229 CCTATGATGGTGGAGTGGGATGG + Intergenic
1117786599 14:59292173-59292195 ACCAGAATGGGGTAGTGGGAAGG + Intronic
1118257249 14:64215831-64215853 CCCACCATGGCAGATAGGGATGG - Intronic
1118404897 14:65413117-65413139 CCCACGATGGGGGAGTGGGAAGG - Intronic
1118592480 14:67411890-67411912 CCCACCATGGGGGTTGGGGATGG + Intronic
1119192665 14:72693792-72693814 CCAACCATGGGGTGGTGGAAGGG - Intronic
1120048626 14:79838736-79838758 CCCACCATGTCTGAGTGGCATGG - Intronic
1121050978 14:90818725-90818747 CCCACCAAGAGGGAGCAGGAAGG + Intergenic
1121145422 14:91578246-91578268 CCCACCATGGGGCGGGGGGGGGG - Intergenic
1121308235 14:92920848-92920870 CTCCCCATGGGGGAGAGAGAGGG + Intergenic
1121451137 14:94008971-94008993 CCCATCCTGGGGGATTGGCAGGG + Intergenic
1121711690 14:96043356-96043378 CTCATTATGGGGGAATGGGATGG + Intronic
1121719428 14:96098817-96098839 GCCACCATGTGGGAGGAGGAAGG - Intergenic
1121790378 14:96695128-96695150 CCCAGCATGGGTCAGTGGCATGG - Intergenic
1122153597 14:99737680-99737702 CCCAGCATGGGGGGGTGGCCAGG + Intronic
1122352165 14:101102690-101102712 TCCATCATGGGGCTGTGGGAGGG - Intergenic
1122585738 14:102805206-102805228 CCCATCATGGGGGAGTTTGGAGG + Intronic
1122977879 14:105178431-105178453 CCCAGTGTGGGGGAGTGGGAAGG - Intronic
1124066835 15:26352873-26352895 CACACCTTGTAGGAGTGGGAAGG - Intergenic
1124103001 15:26713013-26713035 GCCACCATGGGGGAGTTCCAGGG + Intronic
1128708899 15:69857418-69857440 GCCAGCATTGGGGAGTGTGACGG + Intergenic
1129281276 15:74486914-74486936 CCCAGCATTGGGAAGTAGGAAGG + Intergenic
1130549520 15:84881099-84881121 TCCTCCATGGGGGAGTATGACGG - Intergenic
1131263905 15:90904419-90904441 CCCTCCAGCGGGGGGTGGGAGGG - Intronic
1131569975 15:93524697-93524719 CACACAAGGGGGGAGTGGGTGGG + Intergenic
1132057078 15:98660420-98660442 CCCACCATTGGGGAGGGGAATGG + Intronic
1132736180 16:1387261-1387283 CTCACCATGGGGGATTGATAGGG - Intronic
1133061117 16:3175142-3175164 CCCACCAGGGGGAGGTGGGCTGG - Intergenic
1133275996 16:4638823-4638845 CCGAGGAAGGGGGAGTGGGAAGG - Intronic
1134101665 16:11456858-11456880 GCCACCCTGTGGAAGTGGGAAGG - Exonic
1135401943 16:22172102-22172124 CCCACCCAGGGGGAGAGGAAAGG + Intronic
1135597741 16:23756292-23756314 CCCACCTTGGAGGAGGGGGGAGG - Intronic
1136229136 16:28876786-28876808 CCCACTTTTGGGGAGGGGGATGG - Intergenic
1137551342 16:49439778-49439800 GCCACCATGAGGGAGGGGGGCGG + Intergenic
1137830515 16:51539217-51539239 CACAGGATGGGGGAGAGGGAGGG + Intergenic
1139419779 16:66843305-66843327 TCCCCCAAGGGGGAGTGAGAAGG - Intronic
1139472681 16:67186706-67186728 GCCTCCATGGGGCAGTGGGGAGG - Intronic
1139958217 16:70703392-70703414 CCCACCATGGGGCTGGAGGAGGG + Intronic
1140264334 16:73407551-73407573 CACAGCATGAGGGAGTGGCAGGG + Intergenic
1141621823 16:85240391-85240413 CCCACCAAGGGGGAGGGGGGTGG + Intergenic
1142150919 16:88512225-88512247 GCCCTCATGGGGAAGTGGGAGGG - Intronic
1142617274 17:1143617-1143639 CCCACCATGGGCGGGTGTTATGG + Intronic
1143032177 17:3973975-3973997 TCGACCAGGAGGGAGTGGGAGGG - Intergenic
1143405761 17:6676431-6676453 CCCACCTTGGGGAGGTGAGATGG - Intergenic
1143477418 17:7210923-7210945 CCCTCCATGGGGGTGGGGCAGGG - Intronic
1144875762 17:18396312-18396334 CCCAGCCTGGGGGGGTGGGGGGG + Intergenic
1145156466 17:20548109-20548131 CCCAGCCTGGGGGGGTGGGGGGG - Intergenic
1147190392 17:38735104-38735126 CCCACCTTGGGGGTGGGGGGCGG - Exonic
1147212512 17:38880095-38880117 CCCTCCATTGGGTAGTGGGGTGG + Intronic
1147228073 17:38996374-38996396 CTCAGCAAGAGGGAGTGGGAAGG - Intergenic
1147403541 17:40194866-40194888 CCCAAAGTGGGGGAGGGGGATGG + Exonic
1147535885 17:41323227-41323249 CCCAGCATGGTGGAGTGGAGAGG - Intergenic
1148442286 17:47717564-47717586 CCCTGCATGGGTGAGGGGGAAGG + Intergenic
1148680572 17:49471155-49471177 CCCACCAGGCTGGAGGGGGAGGG + Intronic
1149602937 17:57904758-57904780 CCTACCGTAGGGGAGTGGGGGGG + Intronic
1149614543 17:57987668-57987690 CCCACCGTGGGGGACCGGGCCGG + Intronic
1150351815 17:64451081-64451103 TCCACCACTGGGGAGTGGGTGGG - Intronic
1151219009 17:72597895-72597917 TCACACATGGGGGAGTGGGATGG - Intergenic
1151963454 17:77419407-77419429 CCCACCCTAGGGAAGCGGGAGGG - Intronic
1152064353 17:78102262-78102284 GTCACCACGGGGAAGTGGGAAGG + Intronic
1152403855 17:80085476-80085498 CCCACCATGGGGAAGCTAGAGGG + Intronic
1152532289 17:80925744-80925766 CTCACCATTAGGGAGTGGGAAGG - Intronic
1152667555 17:81580096-81580118 CCCACCTTGGGGGAATGAGGTGG - Intronic
1153066007 18:1045796-1045818 CCCACCGGGAGGAAGTGGGAGGG + Intergenic
1153522029 18:5962524-5962546 CCCACCAGGGTGGAGTGCCAAGG - Intronic
1156399423 18:36727371-36727393 CCCAAGATGAGGGAGTGGGTTGG - Intronic
1159026277 18:63184651-63184673 CCCATCAGGGGAGAGTAGGATGG + Intronic
1160897266 19:1408530-1408552 ACCACTTTGGGGGGGTGGGATGG - Intronic
1160974304 19:1785132-1785154 GCCCCCATGGGGAAGTGGGACGG - Intronic
1161238168 19:3208136-3208158 GCCACCATCGGGGAGCGGGAGGG - Exonic
1161761396 19:6175535-6175557 CCAGCCATGGGGGTGGGGGACGG + Intronic
1161821147 19:6531839-6531861 CCCTCCATGTGGCAGTGGGTGGG + Intronic
1161852722 19:6746038-6746060 CCCCCCAGGGGGGAGAGGGGTGG - Intronic
1161978984 19:7620820-7620842 CCCACCGTGGGGGGCTGGGCCGG - Intronic
1162088435 19:8262216-8262238 CCCACCCGGGGTGGGTGGGAAGG + Exonic
1162592832 19:11604315-11604337 CCCACCCTGATGGAGTGTGATGG - Intronic
1163633852 19:18429589-18429611 CCCACCCTCGGGGAGTGGACCGG + Intronic
1164662453 19:29988469-29988491 ACCACCAAGGGGCAGTGTGAGGG - Intronic
1164751036 19:30654833-30654855 CCCAGCATGGGGGGGTGTGTGGG - Intronic
1166093254 19:40523688-40523710 CCCAGCATAGGGGAGTGGTGTGG + Intronic
1166094554 19:40530735-40530757 CCCACCCTGGGGGAGGGGCAAGG + Intronic
1166100110 19:40566587-40566609 CCTGGGATGGGGGAGTGGGAGGG + Intronic
1166373467 19:42314707-42314729 CTCAGCCTGGGGGAGTGGGCAGG + Intronic
1166944951 19:46390748-46390770 CCCACCATGGGGCTATAGGAGGG - Exonic
1166997825 19:46728172-46728194 CCCTCCGTGGGGCAGTGGGCAGG + Intronic
1167034864 19:46989101-46989123 CCCACCATAGGGGACAAGGATGG + Intronic
1167409628 19:49337252-49337274 CCCAGCAGGGAGGAGAGGGAAGG + Intronic
1167425969 19:49429717-49429739 ACCACCATGGGGGAGTTCAATGG + Exonic
1168545152 19:57244056-57244078 CCCTGCATGGTGGAGGGGGAAGG - Intronic
924969180 2:108743-108765 CCCACAATGGTGGATTGGGTTGG + Intergenic
925336416 2:3102192-3102214 CCCAACATGGGGGCTAGGGAGGG - Intergenic
925670395 2:6304326-6304348 CCCATAATGAGGGAGTGGTAGGG + Intergenic
927960489 2:27238071-27238093 GCCACAATGGGGAGGTGGGAGGG - Exonic
929058738 2:37901896-37901918 CCAACCAAGGGAGAGTTGGAGGG - Intergenic
930476455 2:51888510-51888532 CCCACCCTGGGGGAGGGGAAGGG - Intergenic
930539058 2:52681315-52681337 GCCACCATGGTGGACTGGGCTGG - Intergenic
931207869 2:60165305-60165327 CCCTCAATGGGGAAGTAGGAGGG - Intergenic
931799767 2:65747434-65747456 CAAAGCAAGGGGGAGTGGGACGG - Intergenic
932165936 2:69507088-69507110 CCCTCCTTGGAGGAGTGTGATGG - Intronic
932460630 2:71879712-71879734 CCCAGCATGGGGCAGTGAGCAGG - Intergenic
932650878 2:73554713-73554735 CTCAGCATGGGGGAGATGGAAGG + Intronic
934782175 2:96977687-96977709 CACGCAATGGGGGAGGGGGAAGG + Intronic
935133700 2:100280069-100280091 CCCAACTTGGGGGAGTGCAATGG + Exonic
940195656 2:151091493-151091515 GCCACCATTGGGGAGTGGCGAGG + Intergenic
942426164 2:175863133-175863155 CCCAGGATGGGAGAGGGGGATGG - Intergenic
944518666 2:200540632-200540654 CCCACCATAGAGGAGAGGGAGGG + Intronic
945034815 2:205695830-205695852 CCCAGCATGGGTGAGTGGTGTGG + Intronic
947743257 2:232494594-232494616 CCCACCCTGGGGCTGTGGGCTGG + Intergenic
1170528008 20:17260395-17260417 CCCACCAAGGGGGTGTGGAGGGG + Intronic
1170898765 20:20439603-20439625 CCGATCCTGGGGGAGTGGGCTGG + Intronic
1171121353 20:22571777-22571799 CCCAGCATCGAGCAGTGGGAAGG - Intergenic
1172006124 20:31820061-31820083 CCCAGCCTGGGTGAGAGGGAAGG + Intronic
1172942213 20:38661923-38661945 CCTACTATGGGGGAGGGGGAGGG + Intergenic
1173417058 20:42866066-42866088 CCCAACATGTGGCACTGGGATGG - Intronic
1174054986 20:47792435-47792457 CCTACCAGAGTGGAGTGGGAGGG - Intergenic
1174348483 20:49949382-49949404 CCTCCCCTGGGGGAGTGGCACGG + Intronic
1174419419 20:50390006-50390028 CCAACCACTGGGGGGTGGGAGGG - Intergenic
1175185691 20:57178440-57178462 CCCTCCGTGGGGGAGTAGCAGGG + Intronic
1175270409 20:57729996-57730018 ACAAACATGGGGGAGTGGGCAGG + Intergenic
1175510972 20:59526010-59526032 CCCACTTTGGGGGACTGGGCTGG - Intergenic
1175931534 20:62496065-62496087 CCCTACAAGGGGGAGTGGGCGGG - Intergenic
1177190001 21:17840296-17840318 CCTACCATGGGGCAGAGGTAGGG + Intergenic
1179418908 21:41220357-41220379 CCCAACCTTGGGGAGTGGGGAGG - Intronic
1180124301 21:45778678-45778700 CCCACAATGGTGGATTGGGTTGG + Intronic
1180150646 21:45945495-45945517 CCCTCCCTGGGGCTGTGGGAGGG + Intergenic
1180685981 22:17667209-17667231 CCCACCAGGGTGGAGTGCAATGG + Intronic
1181615616 22:24052201-24052223 CCCTCCATGGTGTAGGGGGAGGG + Intronic
1181964253 22:26645534-26645556 CCCACCACCGGGGAGAGGGCGGG - Intergenic
1181984637 22:26791329-26791351 CCAACAATGGGCCAGTGGGAAGG - Intergenic
1182500488 22:30743250-30743272 CCCAACATGGGAGACAGGGATGG - Intronic
1183252449 22:36739683-36739705 ACCACCATTGTGGAGTAGGAGGG - Intergenic
1183548403 22:38467659-38467681 CCCTCCCTGGGAGAGTGGGGTGG - Intergenic
1184116528 22:42425900-42425922 AACACCTTGGGGGAGAGGGAGGG + Intronic
1184423653 22:44396333-44396355 CCCTCCATGGGGGAGGTGGCGGG + Intergenic
1184741950 22:46433601-46433623 CCCACCATGGTGCCGTGGGGAGG - Intronic
950460909 3:13121789-13121811 CCCAGGATGGGGCAGTGGGCTGG + Intergenic
950681514 3:14588473-14588495 CCCACCTTGAGTGAGTGGGGAGG - Intergenic
950753246 3:15148681-15148703 CCCAGCATGGAGGAGGGGCATGG - Intergenic
954609697 3:51937802-51937824 CCAGCCCTGGGGCAGTGGGATGG - Intronic
954622776 3:52005362-52005384 CCCACCAGGGGAGATTGGGGAGG - Intergenic
954660203 3:52222991-52223013 GCCACCATGGGGGAGGCAGATGG - Exonic
954864516 3:53717546-53717568 CCTACCATGGAGAAGTGGGATGG + Intronic
955326173 3:58010451-58010473 GCCACCCTTGGGGAGGGGGAGGG - Intronic
957655945 3:83075523-83075545 CCTACTATAGGGGAGAGGGAGGG + Intergenic
959623339 3:108422508-108422530 CCCACGATGGGGCAGATGGAAGG - Intronic
959944355 3:112111553-112111575 CCTGCCATGGGGGATTAGGATGG + Intronic
961511267 3:127405228-127405250 CTCACCTTGGGTGAGTAGGAAGG + Intergenic
961603027 3:128075664-128075686 CCCCCCATGGGGGCGTGGCCAGG - Intronic
966168500 3:177049833-177049855 CCCACAGTGGGGGAGAGGGCTGG + Intronic
966863376 3:184242779-184242801 GACAACCTGGGGGAGTGGGAAGG - Intronic
969468119 4:7369798-7369820 CCCACCATGGGCACGTGGCAGGG + Intronic
970192446 4:13529236-13529258 CCCAAAAGGGGGGAGTGGGAGGG - Intergenic
971151821 4:24041279-24041301 CCCAGCAGGGAGGAGTTGGAGGG - Intergenic
973020900 4:45205538-45205560 ACCAAGATGGGGGAGTGTGATGG + Intergenic
974088902 4:57289885-57289907 ATCTCTATGGGGGAGTGGGAGGG + Intergenic
974589485 4:63925472-63925494 CCCACCATGTGGAAGGGAGAAGG - Intergenic
982045910 4:151445449-151445471 CCCAGCAAGGTGGAGTGGGGGGG + Intronic
983484970 4:168322689-168322711 CCCACCCTAGGGGAAAGGGATGG + Intergenic
983887370 4:172995366-172995388 CCCACAATCTGGGAGTGGAAGGG + Intronic
985411430 4:189689794-189689816 CCCACCATGGTGGAGTATAAAGG + Intergenic
986199739 5:5570135-5570157 CCCAGAATGGGGAAGTGGGCTGG + Intergenic
986366784 5:7040803-7040825 CCCAGTATGGGGAGGTGGGAAGG + Intergenic
986446827 5:7828929-7828951 CACCCCGTGGGGGAATGGGAGGG - Exonic
988503110 5:31799632-31799654 CCCAGCAGGGAAGAGTGGGAAGG + Exonic
992873061 5:81025424-81025446 CACACCCTGGGGAAGGGGGAAGG - Intronic
995545816 5:113229157-113229179 CCCAACATGGCGGATGGGGAGGG + Intronic
996505239 5:124261171-124261193 CCCACCATGGGGAAGAGGAGGGG - Intergenic
998139702 5:139692993-139693015 CCCAGCATGTGGGTGGGGGAGGG - Intergenic
1000137627 5:158368078-158368100 GCCACCATGTGGGAATGGGCCGG + Intergenic
1001408732 5:171495372-171495394 GCCACCAAGGGAGAGCGGGAAGG + Intergenic
1001989059 5:176100891-176100913 TCCTCCATGGTGGAGAGGGAAGG - Intronic
1001989678 5:176105903-176105925 TCCTCCATGGTGGAGAGGGAAGG - Intronic
1001999890 5:176191694-176191716 GCCACGGTGGAGGAGTGGGAGGG + Intergenic
1002227192 5:177732234-177732256 TCCTCCATGGTGGAGAGGGAAGG + Intronic
1002266952 5:178041537-178041559 TCCTCCATGGTGGAGAGGGAAGG - Intronic
1002303626 5:178271193-178271215 CCCTCCGTGTGGGAGTGGGGAGG + Intronic
1002792005 6:443881-443903 GTCACCATCGGGGCGTGGGAGGG - Intergenic
1003136043 6:3435397-3435419 CCCATCATAGGGGAGGAGGAGGG - Intronic
1005859193 6:29888259-29888281 CCCTCCGTGGGGGATGGGGAGGG - Intergenic
1006276620 6:33009442-33009464 GCCACCAAGGGTGAGTGCGAGGG - Exonic
1006814376 6:36840263-36840285 TCCATCCTGGGGGAGGGGGAGGG + Intergenic
1007127103 6:39434673-39434695 TCCAGCATGCGGGAGAGGGAGGG + Intronic
1011016332 6:82759836-82759858 CCCATCATGGGGTTGGGGGAGGG + Intergenic
1013542174 6:111121929-111121951 CCCATCCTGGGGAGGTGGGAAGG - Intronic
1016796580 6:148124531-148124553 CCCAGCAGGATGGAGTGGGATGG - Intergenic
1018462054 6:164007729-164007751 CCCAGCATGGTGGAGAGGGCAGG + Intergenic
1018473720 6:164120089-164120111 ACCACCATAGGGGAGAGGGAGGG + Intergenic
1018652248 6:166002304-166002326 GGAACCATGGGGGAGTTGGAGGG + Intergenic
1019540322 7:1548320-1548342 GCCAGCACGGGGGAGTGGGGAGG - Intronic
1019579336 7:1752291-1752313 GCCACCATGGGGCAGTGAGGGGG + Intergenic
1021412420 7:20343379-20343401 CACCTCAAGGGGGAGTGGGAGGG - Intronic
1021931534 7:25585832-25585854 ACCCCCATGGGGGAAGGGGAGGG + Intergenic
1022101661 7:27172990-27173012 CCCACGCGGGGGGAGGGGGAGGG - Intronic
1022522433 7:31016803-31016825 CCCACCCTAGGGGAATGGGATGG + Intergenic
1024219582 7:47277419-47277441 CTCACCATGGTGGGGTGGCATGG + Exonic
1024241478 7:47439620-47439642 CCCACCATGGAGGAGGGCCATGG - Exonic
1025238001 7:57247700-57247722 CCTACCAGAGTGGAGTGGGAGGG + Intergenic
1026150951 7:67787765-67787787 CCCACCATGGCAGAGTGGAGAGG - Intergenic
1026529446 7:71184619-71184641 CCCACCTTGGGAGAGAGGAAGGG - Intronic
1028897797 7:96061590-96061612 CTCACTATTGGGAAGTGGGAGGG - Intronic
1029518512 7:101043988-101044010 CCTGCCATGGGGTAGGGGGATGG - Intronic
1029623118 7:101702314-101702336 CACAGCCTGGGGGAGAGGGAGGG + Intergenic
1032016657 7:128384268-128384290 CCTACCCCGGGAGAGTGGGAGGG + Intergenic
1032026409 7:128446108-128446130 CCCAGGATGGGGGACTGGGGAGG + Intergenic
1032219630 7:129984198-129984220 TCCAACCTGGGTGAGTGGGAGGG + Intergenic
1032471775 7:132184207-132184229 CCCAGCAGGGGGCAGCGGGAGGG + Intronic
1034081414 7:148281040-148281062 TCCACCCTGGGGGAGCGTGAGGG + Intronic
1034433770 7:151053533-151053555 CCCACCAGGGTGGAGAGGAAAGG - Intergenic
1035029956 7:155850296-155850318 CTCCCCATGGGGGAATGGGGTGG + Intergenic
1035214204 7:157352635-157352657 CACACAATGAGGAAGTGGGAAGG - Intronic
1036416003 8:8549183-8549205 CCCACAGTGAGGGAGTGGGGTGG + Intergenic
1036857103 8:12305427-12305449 CCTGTCATGGGGTAGTGGGAGGG + Intergenic
1037362071 8:18084330-18084352 CCCGCGGTGGGGGAGGGGGATGG - Intronic
1038278256 8:26139782-26139804 CTCCCCATGGGGAAGAGGGAGGG - Intergenic
1040041540 8:42920518-42920540 CCAGCCACGGGGGATTGGGAAGG + Intronic
1040459618 8:47634691-47634713 CCCACCATGGCTGAGTGGGAGGG + Intronic
1042844804 8:73159086-73159108 CCCCACATGGAGGAGTGGGCTGG + Intergenic
1044163980 8:88957344-88957366 ACCACAAAGGGGGAGAGGGAGGG + Intergenic
1045368125 8:101494217-101494239 ACCACGAGGGAGGAGTGGGAAGG + Intronic
1045372927 8:101543116-101543138 CCCAGAATGGGGGAGAAGGAAGG - Intronic
1047855722 8:128909187-128909209 CCCACCATGGGGTTGAGGGATGG - Intergenic
1048009427 8:130443858-130443880 GCCACGAGGGGGGCGTGGGAGGG + Intergenic
1048066131 8:130970586-130970608 CACACCAGGGTGGAGGGGGATGG - Intronic
1048572393 8:135666901-135666923 TCCACCATGAGTGAATGGGAAGG + Intergenic
1049790422 8:144469854-144469876 CCCAGCAAAGGGGAGTGGGCAGG - Intronic
1056054807 9:82810220-82810242 CCCATCATGAAGGAGTGGGTTGG - Intergenic
1056223004 9:84468342-84468364 GCAACCATGGGGAGGTGGGAAGG + Intergenic
1056707838 9:88967078-88967100 CCCACGTTGGGGCAGAGGGAAGG - Intergenic
1056721855 9:89078793-89078815 TCCTCCATGTGTGAGTGGGAAGG - Intronic
1057063394 9:92026172-92026194 ACCAGCATGTGGGAGAGGGAGGG - Intergenic
1057176757 9:93005930-93005952 TCCACCAGGGGGGTGTGGGGTGG - Intronic
1057903025 9:98964201-98964223 CCAAGAATGGGGGGGTGGGAGGG - Intronic
1057993513 9:99797995-99798017 CCCAACAAGGGGGAGGGGGGAGG + Intergenic
1058843912 9:108936670-108936692 CCCAGGATGGAGGAGGGGGAAGG + Intronic
1059464703 9:114460600-114460622 CCCCCACTGGGGGAGTGGGAAGG + Intronic
1059490967 9:114667086-114667108 ACCCCTATGGGGGGGTGGGAAGG + Intergenic
1060741322 9:126099452-126099474 GCCACCATGTGGGAGGGGGCAGG + Intergenic
1061010642 9:127952423-127952445 TCCACCATGGAGAAGAGGGATGG + Intronic
1061941670 9:133887251-133887273 CCCAGGATGGGGGTGGGGGAAGG + Intronic
1062050434 9:134444152-134444174 CCCATTATGGGGGATGGGGAAGG + Intergenic
1062334012 9:136057014-136057036 CCCACCCTGGGGGTGGGGGCTGG - Intronic
1062519552 9:136952003-136952025 CCCAGCATGGGGCACTTGGAAGG + Intronic
1203671166 Un_KI270755v1:13188-13210 CCCACCATGGTGGAGTATAAAGG - Intergenic
1186140463 X:6566810-6566832 CAAACCAAGGGAGAGTGGGAGGG + Intergenic
1186637964 X:11426941-11426963 GCCACCATAAGGGAGGGGGAAGG + Intronic
1187613068 X:20963082-20963104 CCAACCAGGGGAGAGTGGTATGG + Intergenic
1187744929 X:22398935-22398957 CCCTCAATGGGGTAGTGGCAAGG + Intergenic
1189645832 X:43130458-43130480 CCCCCCATGGGGAAGTAGGTAGG - Intergenic
1190879601 X:54483244-54483266 CCCACCGCGCGGGTGTGGGAGGG - Intronic
1191640758 X:63428239-63428261 CCCACCATTGTGGCGTGGGCTGG + Intergenic
1192249182 X:69397034-69397056 TCCACGAAGGGGGAGGGGGAGGG - Intergenic
1194053415 X:89100796-89100818 CCCACCGTGGGGGATGGGGGTGG + Intergenic
1195704126 X:107726192-107726214 CTCTCCAAGGGGGAGTAGGAGGG + Intronic
1196033365 X:111115459-111115481 CCCACCATTGTGAAGTGGGATGG + Intronic
1198144880 X:133845046-133845068 CCCACCAAGGAGGACTGTGAGGG - Intronic
1198613235 X:138425305-138425327 CACAGGATGGGGGAGTGGGGTGG - Intergenic
1200058278 X:153472741-153472763 CCTACCATGGGGGAGGGAGGGGG + Intronic
1200141346 X:153904498-153904520 CCAACCAGGGGGGCGTGGTAGGG + Intronic
1201347212 Y:12998512-12998534 ACCCCCTTTGGGGAGTGGGAAGG + Intergenic