ID: 1090778393

View in Genome Browser
Species Human (GRCh38)
Location 11:129984882-129984904
Sequence CTGGATAATGAGAAGGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 392}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090778393_1090778399 8 Left 1090778393 11:129984882-129984904 CCTACCTCCTTCTCATTATCCAG 0: 1
1: 0
2: 2
3: 34
4: 392
Right 1090778399 11:129984913-129984935 GTCAATGCTACCTCCTCAGTAGG 0: 1
1: 0
2: 3
3: 10
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090778393 Original CRISPR CTGGATAATGAGAAGGAGGT AGG (reversed) Intronic
900380350 1:2381092-2381114 CTGGATAATGAGGAGAAGCGAGG - Intronic
901024756 1:6273303-6273325 ATGGGTGCTGAGAAGGAGGTTGG - Intronic
901371714 1:8804338-8804360 CTGGATACTGAACTGGAGGTGGG + Intronic
903056153 1:20637651-20637673 CTGAATAATGAGAAAGAAGATGG + Intronic
903284057 1:22266300-22266322 CTGGATAGTAAGTGGGAGGTGGG + Intergenic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
905068114 1:35201099-35201121 CTGGAAAATAGGAAGGAGGAAGG - Intergenic
905119797 1:35672861-35672883 CAGGATCATCAGAAGGAGGTGGG - Intergenic
905293101 1:36936585-36936607 CTGGAGAATGGGAATGGGGTGGG - Intronic
905710726 1:40100088-40100110 CTGGATAAAGAAAATGTGGTAGG - Intergenic
906530007 1:46518321-46518343 GTGGCTCATGAGAAGGAGGTGGG + Intergenic
906862720 1:49379027-49379049 CTGGATAAGGAAAATGTGGTAGG + Intronic
906940671 1:50252524-50252546 CTGGATAATGGGGAGGGGGAAGG + Intergenic
907110706 1:51923901-51923923 CTGAAGAATGAGAAGAAGTTAGG - Intronic
911670068 1:100597809-100597831 CTGGATAAGGGGATGGAGGATGG + Intergenic
912469222 1:109895192-109895214 CTGGGGAGTGAGTAGGAGGTAGG - Intergenic
912708231 1:111930607-111930629 ATGGTTACTGAGAAGGGGGTTGG - Intronic
913283726 1:117209229-117209251 CTGGAGGATTAGCAGGAGGTGGG - Intronic
914222316 1:145692121-145692143 CTTGGTAATGAAAAGGAGGGTGG + Intronic
914730750 1:150368126-150368148 CTAAACAATGAGAAGGAGGCAGG - Intronic
915168129 1:153959922-153959944 CTGACTAATGAGAGGGAAGTGGG - Exonic
915347211 1:155203593-155203615 CTGGTTGGTGAGAAGGAGGAAGG + Intronic
915646251 1:157274758-157274780 AGGGATAATGAGGAGGAGGGAGG + Intergenic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
917097961 1:171418391-171418413 CAGGACAACTAGAAGGAGGTGGG + Intergenic
917473704 1:175349817-175349839 CTGGCTGTGGAGAAGGAGGTAGG - Intronic
917478318 1:175387750-175387772 CTGGAGACAGAGTAGGAGGTGGG - Intronic
920309697 1:205041860-205041882 CTGGAAAAGGAGAAGGAGTCGGG - Intergenic
921388373 1:214594406-214594428 CTGAATGATGAGAGGGAAGTGGG + Intergenic
922071001 1:222193422-222193444 CTGGATAATGGGAAAGGTGTAGG - Intergenic
923282257 1:232455379-232455401 CTGGATAAAGAAAATGTGGTTGG + Intronic
923976534 1:239270726-239270748 CCTGATCAGGAGAAGGAGGTAGG - Intergenic
1063281520 10:4634289-4634311 TTGGAGACTGAGAAGGAGGGAGG + Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1065035120 10:21630211-21630233 ATGGATCATGAGATTGAGGTGGG + Intronic
1065186041 10:23172289-23172311 ATCGAAAATGAGATGGAGGTCGG + Intergenic
1066142439 10:32519860-32519882 TTGGAGTGTGAGAAGGAGGTGGG - Intronic
1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG + Intergenic
1067466065 10:46500126-46500148 CTGGATTATGAGAAGGAGCAGGG + Intergenic
1067621123 10:47884480-47884502 CTGGATTATGAGAAGGAGCAGGG - Intergenic
1067909542 10:50332174-50332196 CTGGAGAATGATAGGGAGGGTGG - Intronic
1068487187 10:57674913-57674935 TGGGAGAATGAGGAGGAGGTTGG + Intergenic
1068718797 10:60218899-60218921 CTAGAATATGAGAAGGAGATGGG - Intronic
1069961249 10:72080695-72080717 CTGGATAAACAGAAGGAGACAGG + Intronic
1072834279 10:98694746-98694768 GTGGATAGGGAGAAGGAGATAGG - Intronic
1073190705 10:101648891-101648913 CTTGATGATAAAAAGGAGGTGGG - Intronic
1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG + Intronic
1073979687 10:109140886-109140908 CAGGATGAAGAGAGGGAGGTGGG + Intergenic
1074061753 10:109972816-109972838 CTGGAGAATGAGAGAAAGGTTGG - Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075759581 10:124845907-124845929 CTGGAGAATGAGGATGAGGATGG - Intergenic
1077174236 11:1181426-1181448 GTGGAGAAGGAGAAGGTGGTTGG - Intronic
1078297204 11:10084703-10084725 CTGGATAAAGAAAATGTGGTAGG + Intronic
1079104922 11:17564437-17564459 CTGGGTAAGGAGAGGGAGGGAGG + Intronic
1080562493 11:33476704-33476726 CTGAATGATGAGCAGGAGCTGGG - Intergenic
1081747057 11:45480767-45480789 CAGGATGATGGGAAGGTGGTGGG + Intergenic
1083757959 11:64801595-64801617 CTGGAGAGTGAGGAGAAGGTTGG + Exonic
1083994223 11:66264241-66264263 CTGGAGGATGGGAAGGAGGGAGG + Intronic
1084148981 11:67279305-67279327 CTGGAGAAAGGGGAGGAGGTTGG + Intronic
1084782846 11:71422399-71422421 CTGGTGAATGAAAAGCAGGTTGG - Intergenic
1085309014 11:75505302-75505324 CTGGATCCTGAGAGGGAGGCAGG - Intronic
1085995809 11:81912268-81912290 CTGTATAATAATAAGAAGGTAGG - Intergenic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1090696898 11:129254383-129254405 GTGGAGAATGGGAAGGAGGAAGG - Intronic
1090778393 11:129984882-129984904 CTGGATAATGAGAAGGAGGTAGG - Intronic
1090905490 11:131070938-131070960 CTTAATAAGGGGAAGGAGGTAGG - Intergenic
1090959601 11:131544379-131544401 CTGGAGAAAGAAGAGGAGGTAGG - Intronic
1091027242 11:132152585-132152607 CCGGAGAATGACAAGGAAGTAGG + Intronic
1091907818 12:4203068-4203090 CAGGATCTAGAGAAGGAGGTGGG - Intergenic
1092388842 12:8057196-8057218 CAGAAAAATGAGAAGGTGGTAGG + Intergenic
1092759890 12:11800215-11800237 ATGGATGATGAATAGGAGGTGGG - Intronic
1093938450 12:25026466-25026488 AAGGATAATGAAAAGGTGGTCGG + Intronic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094776445 12:33734062-33734084 GTGGACAATGAAAAGAAGGTTGG - Intergenic
1095740034 12:45596912-45596934 CAGGAAGATGAGAATGAGGTGGG - Intergenic
1096056906 12:48660847-48660869 CAGGATCCTGAAAAGGAGGTTGG - Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096490811 12:52011878-52011900 CTGGTAAGTGGGAAGGAGGTAGG - Intronic
1097988445 12:65808931-65808953 CTGGAAACTGAGAAAGAGGATGG - Intergenic
1098003538 12:65970771-65970793 CTGAAGACTGAGGAGGAGGTTGG - Intergenic
1098029983 12:66243529-66243551 ATGGATATTGAGAAGGAGGTGGG - Intronic
1098185683 12:67893593-67893615 CTGGATAATGATTAGGAAGTTGG - Intergenic
1098227368 12:68338629-68338651 CTGCAGTAGGAGAAGGAGGTTGG - Intergenic
1099028525 12:77495684-77495706 CTGGACAATGAGAAACTGGTGGG + Intergenic
1100122819 12:91388549-91388571 CTGGCAAATGAGAACTAGGTTGG + Intergenic
1100596720 12:96078334-96078356 CTGGAAAATGTGATGGAGGAGGG + Intergenic
1101541627 12:105670780-105670802 ATGGAGTATGAGAAGGAGGTAGG - Intergenic
1101847387 12:108373412-108373434 CTGGAAAATGAGAAGCAGACAGG - Intergenic
1102359556 12:112272664-112272686 CTGGATAGTGAGAAAGCTGTGGG - Intronic
1102488885 12:113277010-113277032 CTGGCTGATGAGCAGGCGGTAGG - Exonic
1103220377 12:119239343-119239365 CTGGAGAGTGATAAAGAGGTTGG + Intergenic
1103355680 12:120318092-120318114 CTTGATAATGAAAAAGAGGTAGG + Intergenic
1103992104 12:124806189-124806211 CTGGACAATGAGGCGGGGGTTGG + Intronic
1108095319 13:46894522-46894544 CTAGAGAATGTGAAGGAGGAAGG - Intronic
1108464813 13:50704838-50704860 CTTGAAAATGAGAAGGTGATTGG + Intronic
1108493230 13:51001375-51001397 CTGGAGCCTGAGAAGCAGGTTGG + Intergenic
1109399010 13:61800055-61800077 ATGGAGAATGAGAAGGAGAATGG + Intergenic
1109850711 13:68059256-68059278 ATGGATAATGAGAGAGTGGTAGG - Intergenic
1109898791 13:68734033-68734055 ATGGCTAATGAGAAGGAGTGGGG + Intergenic
1110233525 13:73192253-73192275 CCGGAGAGTGAGAAGGAGGCAGG - Intergenic
1110237768 13:73234342-73234364 CTGGAAAGGGAGGAGGAGGTGGG - Intergenic
1110769440 13:79322170-79322192 CTGGATAATGAGAAGAAATGTGG - Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1112783146 13:102924042-102924064 CTTGAGAATGAGAATGAGTTTGG - Intergenic
1115094535 14:29618964-29618986 CTGGAGAATGAGGAGGAGGAAGG + Intronic
1117162400 14:53002231-53002253 CTGGGAGATGAGAAGGAGGGAGG - Intergenic
1117541038 14:56746735-56746757 GTGGATGATGAGGAGGAGGGTGG + Intergenic
1117872474 14:60215740-60215762 ATGGAGAATGTGAATGAGGTTGG - Intergenic
1118033134 14:61837836-61837858 CTGGATACTGAGAAAGACATAGG - Intergenic
1120953682 14:90063253-90063275 CTGGCTAATGGGATGGAGGCGGG + Intronic
1121254459 14:92521059-92521081 CTGGATGATGATTAGGAGGATGG - Intronic
1121599286 14:95191155-95191177 CTGCTTAATGAGAAAGAGGGTGG - Exonic
1125293604 15:38177196-38177218 CTAGATAATGAGAATGAGCTGGG - Intergenic
1125320342 15:38480434-38480456 CTAGTTAATTAGATGGAGGTAGG + Intronic
1125602027 15:40920705-40920727 TTAGATAAAGAGAAGGGGGTGGG - Intergenic
1125608822 15:40957482-40957504 CTGGGCAATGAGGAGGAGGCTGG - Intergenic
1128328640 15:66741481-66741503 CTGTAAAATGAGGAGGAGGTGGG + Intronic
1128545677 15:68566092-68566114 CTGGATGAGGAGAAGGGGTTGGG + Intergenic
1129053174 15:72799184-72799206 CTGGAGAATGAGAAGGGGACAGG - Intergenic
1129119310 15:73386082-73386104 ATGGCTGCTGAGAAGGAGGTGGG + Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130517819 15:84639698-84639720 CTGGAGGATGAGAAGGTGGCAGG + Exonic
1131662872 15:94537607-94537629 ATGAAAAATGAAAAGGAGGTAGG + Intergenic
1131703649 15:94969168-94969190 CAGGATAAGGAGAGGGAGCTGGG + Intergenic
1133402202 16:5496407-5496429 CTGAATAGTGAGAAGGAGCTGGG - Intergenic
1133612601 16:7447551-7447573 ATGGATAATGAGAAGGTGACTGG - Intronic
1135231196 16:20709666-20709688 CTGTATAAGGATAAGGAAGTGGG - Intronic
1136605221 16:31329321-31329343 CTGGGTCCTGAGAAGGAGGCTGG + Intronic
1136618722 16:31413824-31413846 CTGGAGAATGAGCAGGAGCCAGG - Intronic
1137701696 16:50502358-50502380 CTGGGAGATGGGAAGGAGGTAGG + Intergenic
1138319403 16:56099056-56099078 CAGCAAAAAGAGAAGGAGGTGGG + Intergenic
1138342885 16:56302295-56302317 GTGGATCCTGGGAAGGAGGTAGG - Intronic
1138574992 16:57901830-57901852 CTGAAGAATGAGTAGGAGTTTGG - Intronic
1138659084 16:58507322-58507344 CTGCAAAATGAGGAAGAGGTCGG + Intronic
1138739941 16:59296319-59296341 CTGGATAATGAAAGGGATTTAGG + Intergenic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1142065639 16:88060863-88060885 CTGGATGGTGAGAGGGAGGGTGG - Intronic
1142853477 17:2716782-2716804 CTGCATAAAGATAAGGAGGAGGG + Intergenic
1143758871 17:9086867-9086889 GGTGATATTGAGAAGGAGGTGGG - Intronic
1143902446 17:10184300-10184322 CTTGATCATGAGGTGGAGGTGGG - Intronic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1144003888 17:11082060-11082082 CTGGTTCATGAGGAGGAGGGTGG - Intergenic
1144082451 17:11776486-11776508 CTGCCTAAAGAGAAGGAGGTTGG + Intronic
1145212990 17:21028940-21028962 CAGGATCAGGAGCAGGAGGTGGG - Intronic
1145839647 17:27983745-27983767 CTGCATATTGAGAAGGGGGCTGG + Intergenic
1147011534 17:37452971-37452993 CTGGATAATCTGAAGAAGGGAGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148765716 17:50037262-50037284 CAGGAATAGGAGAAGGAGGTGGG + Intergenic
1150052678 17:61980258-61980280 AAGGAAATTGAGAAGGAGGTTGG - Intronic
1150992516 17:70276119-70276141 CTGGATAATGGGGAGGGGATGGG + Intergenic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1151563706 17:74885123-74885145 CTGCACAGTGAGGAGGAGGTGGG - Intronic
1152012219 17:77725612-77725634 CTGAAGTAGGAGAAGGAGGTTGG + Intergenic
1152095882 17:78271422-78271444 GTGGAGGATGAGCAGGAGGTGGG + Intergenic
1153847365 18:9062089-9062111 CAGAATAATGAGAAGTATGTGGG - Intergenic
1153909827 18:9696968-9696990 CTAGACACTGAGAAGGAGGTTGG - Intergenic
1154382682 18:13866927-13866949 CTGGATAATTAGAAAGATGGTGG - Intergenic
1156661999 18:39357312-39357334 ATGGATTATCAGATGGAGGTTGG - Intergenic
1157814811 18:50722841-50722863 CTGGAGATTGAGAGGCAGGTGGG - Intronic
1158996287 18:62923494-62923516 CAGGATTATGTGAAGGGGGTGGG + Intronic
1159196763 18:65125812-65125834 CTTGATAATTAGAAGGGGGAAGG - Intergenic
1161509589 19:4663113-4663135 CTGTAGAATGAGGATGAGGTGGG - Intronic
1161509719 19:4663640-4663662 CTGTAGAATGAGGATGAGGTGGG - Intronic
1162969167 19:14169807-14169829 AGGGATAATGGGAAGGAGGGAGG + Intronic
1163373231 19:16914303-16914325 CTCGATAATGAGCAGAAGGAGGG + Intronic
1163612291 19:18307873-18307895 CTGGAGGAGGAGGAGGAGGTAGG + Intronic
1165821184 19:38677102-38677124 CTGAAGAATGAGGAGGAGGTAGG - Intronic
1166549776 19:43657539-43657561 CTGAAGAATGAGTAGGAGTTAGG - Intronic
1166721357 19:44998346-44998368 CAGGATAACGAGAAGGAGTTCGG - Intergenic
1167448894 19:49555929-49555951 CTGGCTAAGGAGTAGGAGTTGGG + Intronic
1167519647 19:49946387-49946409 CTGGATAAAGAAAATGTGGTGGG - Intronic
1167649592 19:50722144-50722166 CTCGATGATGAGAAGGAGCTGGG + Intergenic
1168084463 19:54035141-54035163 CTGGACAATTTGAAGGAGGCAGG + Intergenic
925991781 2:9260284-9260306 CTGGGTCATGAGGATGAGGTGGG + Intronic
926148438 2:10411270-10411292 CAGGACAATGGGAAGGAGGTGGG + Intronic
926228402 2:10984437-10984459 CTGGGCACTGAGAAGGAGGCAGG - Intergenic
928220427 2:29398691-29398713 CTGGAAACTGGGAAGGAGGAGGG - Intronic
928283434 2:29968554-29968576 CTGGCCAAAGAGAAGAAGGTGGG + Intergenic
928324829 2:30311157-30311179 CAGGAAAATGAGAGGGAGGAGGG + Intronic
928807563 2:35178879-35178901 CTGGATTCTGAGATGGAGGAAGG - Intergenic
930348847 2:50223360-50223382 CTGGTTATTGAGAAGGGTGTTGG - Intronic
930374778 2:50551293-50551315 ATGGAAATTGAGAAGGAGTTGGG - Intronic
930732432 2:54741133-54741155 CTGGACAATAAGAATGAGGAGGG - Intronic
930831205 2:55745187-55745209 CTGGAGAAAGAAAAGGAGCTTGG - Intergenic
931015138 2:57968713-57968735 CTGAATAATGAGAAAGAAATTGG + Intronic
931163791 2:59723254-59723276 CTGGAAAAGGAGGAGGAAGTAGG + Intergenic
932578225 2:72974422-72974444 CTGGATGAGGGGAAGGAGGCTGG - Intronic
932823486 2:74920801-74920823 CTGGACATTGAGAGGGAGGCAGG - Intergenic
935715037 2:105932184-105932206 ATGGGCAATGGGAAGGAGGTGGG - Intergenic
936756368 2:115717662-115717684 CTGGAAAATGAACAGGAGTTAGG + Intronic
936948777 2:117956107-117956129 CTGGATGAGGAAAATGAGGTAGG - Intronic
938115147 2:128597453-128597475 ATGGAAACTGAGAAGGAGATGGG + Intergenic
938503832 2:131853866-131853888 CTGGATTATGGAGAGGAGGTGGG - Intergenic
938929845 2:136076992-136077014 AGAGATAATGAGAAGGAGGGTGG + Intergenic
939176253 2:138751037-138751059 CAGGGTAATGAGAAAGAGATGGG - Intronic
939803697 2:146745750-146745772 CTCAATAATGAGAAAGAGTTTGG + Intergenic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
940525535 2:154808821-154808843 CAGGAGAAGGTGAAGGAGGTGGG + Intronic
940931646 2:159439213-159439235 CTGGATAACGACAAGGTAGTTGG + Intronic
941304167 2:163840872-163840894 CTGGATCATGAGAAGGACAGCGG + Intergenic
941646801 2:168049246-168049268 CTGGATAATGACAAGAATGGAGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
943387861 2:187224818-187224840 CTGGTTAATGAGATGGAGAGTGG + Intergenic
943413891 2:187573954-187573976 CTGGATAAAGAAAATGTGGTTGG - Intergenic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947415607 2:229892199-229892221 GAGGATAATGGGAAGGAGGAAGG + Intronic
947728113 2:232412871-232412893 CTGGATTGTAAGAAGGAGGGAGG + Intergenic
948302140 2:236915508-236915530 CAGGAAATTCAGAAGGAGGTTGG - Intergenic
948856047 2:240731141-240731163 TAGGCTAGTGAGAAGGAGGTGGG + Intronic
949064508 2:241981521-241981543 CTGCAGAGTGACAAGGAGGTAGG - Intergenic
1169712441 20:8580056-8580078 CAGCCTAATGAGAAGGTGGTGGG + Intronic
1169879140 20:10328024-10328046 CTGGAGAATGAGAGGGATGTGGG - Intergenic
1170149851 20:13218425-13218447 CTAGATACTGGGATGGAGGTGGG + Intergenic
1170350102 20:15430132-15430154 CTGGATAAAGAAAAGATGGTAGG - Intronic
1170458348 20:16554093-16554115 CTGGGTAGAAAGAAGGAGGTGGG + Intronic
1170508921 20:17057302-17057324 CTGGACATTAATAAGGAGGTTGG + Intergenic
1171557988 20:26095699-26095721 CGGCATAATGGGAAGGAAGTAGG - Intergenic
1172268735 20:33640153-33640175 CTGGGTACGGAGATGGAGGTGGG - Intronic
1173110187 20:40180097-40180119 CTGGAAAATCAAAAGGGGGTGGG - Intergenic
1173406323 20:42768983-42769005 CTGGGTCATGAGAATGAGGCAGG - Intronic
1173890923 20:46509600-46509622 ATGGAAAATGAGAAGGAGGTGGG - Intronic
1174039847 20:47691375-47691397 CTGAATGATGAGAAGGAGCTGGG + Intronic
1175152659 20:56947237-56947259 CTGGATAATGGGATGGAAATGGG + Intergenic
1175301842 20:57948530-57948552 GTGTATACTGAGAAGGAGGCTGG - Intergenic
1175499785 20:59441631-59441653 ATGGAGAATGACAAGGAGGGAGG + Intergenic
1177009102 21:15709841-15709863 CAGGATCCTGAGAATGAGGTTGG - Intergenic
1179606197 21:42517048-42517070 CTGGACAAGGAGATGGAAGTAGG + Intronic
1180189481 21:46155628-46155650 CTGGTTAATGAGAAGCCGGTGGG - Intronic
1182192499 22:28477351-28477373 ATGGATCATGGGAAGGAGTTTGG - Intronic
1182227282 22:28808736-28808758 CAGGACAATTAGAAGTAGGTGGG + Intergenic
1182668302 22:31974825-31974847 CTGAATGATGAGAAGGAGCCAGG + Intergenic
1182812379 22:33128372-33128394 CTGGATAAAGAAAATGTGGTAGG + Intergenic
1183029859 22:35095473-35095495 CTGGCAATGGAGAAGGAGGTTGG + Intergenic
1183792849 22:40087776-40087798 CTGGAGACTGAGAGGGAGGCAGG + Intronic
1184573696 22:45344603-45344625 CTGGATACTGAGAAAGATCTAGG + Exonic
949541759 3:5038062-5038084 CTGGATACAGAGGAGGTGGTGGG + Intergenic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
950774945 3:15341307-15341329 GTGGATGATGAGAAGGAGTCAGG - Intronic
951679936 3:25284060-25284082 CAGCAAAATGAGAAGGAGGGAGG - Intronic
951685611 3:25340730-25340752 CTGGAGAACAAGAAGGAAGTAGG + Intronic
952110145 3:30113345-30113367 ATGGAGAATGAGAAGGTGCTAGG - Intergenic
952286038 3:31970641-31970663 CTTTAAAATGAGATGGAGGTGGG - Intronic
954966350 3:54614586-54614608 CTGGGGAATGAGAAGGAAGGAGG - Intronic
955678032 3:61469847-61469869 AGTGATAATGAGGAGGAGGTGGG - Intergenic
955909356 3:63844197-63844219 GTGGCTAGGGAGAAGGAGGTTGG + Intronic
956553012 3:70482958-70482980 CTGGAGAATGAGAAAGGGGCTGG + Intergenic
956724457 3:72145750-72145772 CTGGAGAGTGGGAAGGGGGTAGG - Intergenic
957152097 3:76499083-76499105 CTGGGTAATGAGCAGGAGTAAGG - Intronic
958561343 3:95751350-95751372 CTGGATATTGAGAAGGAAACAGG + Intergenic
960183771 3:114613986-114614008 AAGGATGAGGAGAAGGAGGTGGG - Intronic
961056656 3:123794393-123794415 CTGAATGAAGGGAAGGAGGTAGG + Intronic
961508015 3:127384223-127384245 CTGGAGCAGGAGGAGGAGGTGGG + Intergenic
961908119 3:130283904-130283926 ATGGCTAATGAAAAGCAGGTGGG + Intergenic
962611593 3:137081748-137081770 CTGGGGAATGAGAATGTGGTGGG + Intergenic
962929345 3:140022675-140022697 GTGGAGAATGGGATGGAGGTGGG + Intronic
965902393 3:173658225-173658247 ATGGAAAATGAGAAGTAGTTAGG - Intronic
967079667 3:186037825-186037847 CTGATGAAAGAGAAGGAGGTGGG - Intergenic
967331154 3:188290986-188291008 CTGTAGCATCAGAAGGAGGTGGG + Intronic
968075836 3:195815812-195815834 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075848 3:195815857-195815879 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075860 3:195815902-195815924 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075872 3:195815947-195815969 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075897 3:195816037-195816059 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075909 3:195816082-195816104 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075921 3:195816127-195816149 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075933 3:195816172-195816194 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075945 3:195816217-195816239 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076095 3:195816780-195816802 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076131 3:195816908-195816930 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968076231 3:195817253-195817275 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076318 3:195817564-195817586 CTGCTTAAGGAGAAGGAGGCCGG - Intergenic
969471082 4:7389689-7389711 CTTGAGAATGAGCAGGAGGGAGG + Intronic
969631791 4:8343254-8343276 CTGGATGAGGAGAAGCAGGGAGG + Intergenic
970524450 4:16917226-16917248 CTGAATAATGATCAGAAGGTAGG - Intergenic
970560693 4:17279352-17279374 CTCTATAAGGAGAAGGAGATGGG - Intergenic
970949625 4:21738768-21738790 CTGGAAATTGAGAAGAAAGTGGG - Intronic
972274676 4:37546038-37546060 ATAGATGATGAGAAGGAGGATGG + Intronic
973095835 4:46198193-46198215 CTGAATGATGAGAAGGTGTTGGG - Intergenic
973235908 4:47904252-47904274 CTCGCTAATGGAAAGGAGGTTGG + Intronic
973678643 4:53292821-53292843 CTGGATAAAGAAAATGTGGTGGG + Intronic
973895388 4:55407210-55407232 GGGGATAACGAAAAGGAGGTGGG + Intronic
974421819 4:61685528-61685550 CTGAAGAATGAGAACGAGATAGG + Intronic
975545480 4:75556277-75556299 GTGGTTAAAGAGAAGGAAGTTGG + Intronic
977090697 4:92671709-92671731 CTGGATAGTGAGAAGCAAGGAGG + Intronic
980794560 4:137664083-137664105 CTAAACAATGAGAAGGAAGTAGG - Intergenic
980822578 4:138036652-138036674 CTGGAGAAGGACAAAGAGGTTGG - Intergenic
982316527 4:154037546-154037568 ATGGCAAAGGAGAAGGAGGTTGG - Intergenic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
983292758 4:165826755-165826777 ATGGAAAATAGGAAGGAGGTGGG - Intergenic
983696778 4:170542023-170542045 GTGGAGAATGAGAAGGAGAGTGG + Intergenic
983837728 4:172413066-172413088 CTGGCTAATGAGAACTAAGTGGG - Intronic
984822837 4:183898160-183898182 CTGGAGAAGGAGAGGGAGGGCGG - Intronic
985222980 4:187727744-187727766 CTGGATGATGGGAAAGAGGCAGG + Intergenic
985285521 4:188332947-188332969 CTGGAACAGGAGAAGGAGCTTGG + Intergenic
986552900 5:8978627-8978649 CTGGAGGAGGAGAAAGAGGTGGG - Intergenic
986784909 5:11105247-11105269 CAGGATTATCTGAAGGAGGTTGG - Intronic
986838915 5:11673084-11673106 CTGGAAAATGAGAAGAAATTTGG - Intronic
989534024 5:42542788-42542810 CTGGAGACTGAGGAGGGGGTAGG - Intronic
990553263 5:56905113-56905135 CAGGATAATGAGAAGAGAGTGGG - Intergenic
990809523 5:59706784-59706806 GTGCATAAGGAGAAGGAGCTCGG - Intronic
991137996 5:63205819-63205841 TTGGAAAATGAAGAGGAGGTGGG + Intergenic
991601368 5:68354564-68354586 CTGGATGAGAGGAAGGAGGTAGG - Intergenic
992472315 5:77070171-77070193 TTGGAGAATGAGGAGGAGATTGG + Intergenic
993174515 5:84466268-84466290 CAGGAGAATGAGAATGTGGTAGG + Intergenic
994672064 5:102774085-102774107 CTGGATAAAGAAAATGTGGTGGG - Intronic
995180998 5:109230127-109230149 CTGGAGAATGAATGGGAGGTAGG + Intergenic
997475066 5:134138036-134138058 CTGAAAAATGAGAAGGAGGGTGG - Intronic
999122664 5:149221110-149221132 CTTGAAAATGAGTAGGAGGTGGG + Intronic
999195002 5:149775819-149775841 GTGGAGAAAGAGAAGGGGGTAGG - Intronic
999632825 5:153588105-153588127 CAGGATAGTGAAAAGCAGGTTGG + Intronic
999651972 5:153776727-153776749 CTGGCTAAAGAAAAGGAGGGTGG + Intronic
1000925413 5:167187800-167187822 CTTTATAATGGGAAGGAGGGTGG - Intergenic
1001562473 5:172678481-172678503 CTGGCTGAGGAGCAGGAGGTGGG - Intronic
1003169216 6:3708011-3708033 CTGGATGATGGAATGGAGGTTGG + Intergenic
1003619364 6:7684275-7684297 CTGGACTCTGAGAAGGAGCTAGG + Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1006644387 6:35505998-35506020 CTGGACACGGAGAAGAAGGTGGG - Exonic
1007058958 6:38918870-38918892 ATGGATAATGAGGAGTCGGTGGG + Intronic
1007373524 6:41442096-41442118 CTGGACTATGAGAGGGAGGAGGG - Intergenic
1007935153 6:45726364-45726386 CTGGATATTGAGAAGAATGCTGG + Intergenic
1008419035 6:51275011-51275033 CTGGAAAATGAGAGGAAGTTGGG + Intergenic
1009568347 6:65345139-65345161 CTGGAAAAAAAGAAGGAGCTAGG + Intronic
1011402787 6:86982040-86982062 CTGGAGAATAAGAACCAGGTGGG + Intronic
1011458861 6:87581976-87581998 CTGGATAAAGAAAATGTGGTTGG - Intronic
1012533017 6:100261328-100261350 GTGGACAATCAGAAGGATGTGGG - Intergenic
1013795997 6:113889601-113889623 CTGGATAAGGAGAAAGATGCTGG + Intergenic
1014307897 6:119765394-119765416 TTGGATAAGGGGAAGGAGGGTGG + Intergenic
1014780930 6:125563823-125563845 CTGAATTCTGAGAATGAGGTGGG - Intergenic
1014850905 6:126338625-126338647 CTGGAGATTGAGAATGGGGTAGG + Intergenic
1014928527 6:127304385-127304407 CTAGATATTCAGAAGGACGTAGG - Intronic
1015063392 6:128996209-128996231 CAGGAGAATGAGAAAGAGTTTGG + Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015582281 6:134738650-134738672 CAGGACAGTGAAAAGGAGGTAGG - Intergenic
1017225021 6:152010955-152010977 AACAATAATGAGAAGGAGGTAGG - Intronic
1018946717 6:168352400-168352422 CTGGAGCAGGAGAAAGAGGTGGG + Intergenic
1018958915 6:168432288-168432310 CTGGAGGATGAGCAGGAGGGAGG + Intergenic
1021320477 7:19204179-19204201 CTGGCTATGGGGAAGGAGGTGGG - Intergenic
1021492973 7:21239939-21239961 CAGGTTAGTGAGAGGGAGGTTGG - Intergenic
1023765175 7:43504085-43504107 CTTGAGAATGAGAAAAAGGTTGG - Intronic
1024603772 7:51008858-51008880 CTGGTGAATGAAAAGGAGGTGGG + Intergenic
1024881478 7:54090841-54090863 CTAGATAATGAGATGTAGATGGG + Intergenic
1025754431 7:64323508-64323530 CTGGATAAAGAAAATGTGGTAGG + Intronic
1026411788 7:70130626-70130648 CAATATAATGAGATGGAGGTGGG + Intronic
1028476737 7:91262363-91262385 TTTGATATTGAAAAGGAGGTTGG - Intergenic
1029008382 7:97233139-97233161 CTAGATAATGGGAAGGGTGTAGG + Intergenic
1031511194 7:122651962-122651984 CTGGAGTATGAGCAGGAGATGGG - Intronic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031903211 7:127432382-127432404 CTTGATAATGACAAGGTAGTTGG + Intergenic
1032719400 7:134538388-134538410 CTGGAAAATGATAGGGTGGTGGG - Intronic
1032724370 7:134577157-134577179 CTGGAAAATGATAGGGTGGTGGG - Intronic
1033984362 7:147205243-147205265 CTGGAGACTTAGAAGGAGGGAGG - Intronic
1034256220 7:149725973-149725995 CTGGATGAGGAGAAGCTGGTGGG - Exonic
1035232727 7:157476125-157476147 CTGGAGAATGAGAAACAGGATGG + Intergenic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1037137353 8:15478651-15478673 CTGGATAAAGAAAATGTGGTAGG - Intronic
1037675053 8:21044061-21044083 GTGGATGATGGGAAGGAGATGGG - Intergenic
1037685891 8:21139127-21139149 TTGGAAAATGACAAGCAGGTGGG - Intergenic
1038688103 8:29737177-29737199 CTGTATAATGACAACCAGGTGGG - Intergenic
1038768231 8:30450447-30450469 CTGGACTTTGAGGAGGAGGTGGG + Intronic
1038790491 8:30663928-30663950 CTGGATAAAGAAAATGTGGTAGG - Intergenic
1038888390 8:31691027-31691049 CTTGAGAATGAGACTGAGGTTGG + Intronic
1039693526 8:39885331-39885353 ATGGACAATCAGCAGGAGGTGGG - Intergenic
1040776077 8:51044674-51044696 CTGGATGATGAGATAGAGGATGG - Intergenic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1041626495 8:60034778-60034800 AGAGATAAAGAGAAGGAGGTAGG - Intergenic
1041682070 8:60604136-60604158 CAGGAGAAAGAGAAAGAGGTGGG - Intronic
1042267219 8:66921237-66921259 TTGGAGAATTAGAAGGGGGTGGG + Exonic
1042360363 8:67876119-67876141 CTGGATAAAGAAAATGAGTTAGG + Intergenic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1045325839 8:101117095-101117117 ATGGAAGCTGAGAAGGAGGTCGG - Intergenic
1045799517 8:106086502-106086524 GGGGATAATGAGCAGAAGGTTGG - Intergenic
1046138679 8:110062376-110062398 CTGGATAGGGAGATGGGGGTGGG - Intergenic
1046366573 8:113239650-113239672 ATGGGTAATGAGTAGGAGGGTGG + Intronic
1046760716 8:118017217-118017239 ATGTATAAGGAGAATGAGGTAGG - Intronic
1047058246 8:121192454-121192476 GTTGATAATGGGAAGGAGCTAGG - Intergenic
1047109492 8:121773363-121773385 GAGGATAATGATAAGGAGATTGG + Intergenic
1047211244 8:122842190-122842212 TTGGAAAATGAGAAGGTTGTAGG + Intronic
1047456994 8:125023928-125023950 CTGGATAATGATACGGTTGTGGG + Intergenic
1049653504 8:143787748-143787770 CAGGATGAGGGGAAGGAGGTGGG - Intergenic
1049825863 8:144667385-144667407 CTGGAGATTGGGAAGGGGGTGGG - Intergenic
1050088678 9:1993411-1993433 CGGGATAAAGGGAAGGAGGAAGG - Intergenic
1051146577 9:14033424-14033446 CTGGACACTGAGAAGTAGCTGGG + Intergenic
1052081925 9:24216838-24216860 CTGGAAAAAAAGAAGGAAGTTGG - Intergenic
1052251603 9:26404974-26404996 CCAGATAATCAGAAGGTGGTAGG - Intergenic
1052599408 9:30605285-30605307 CTGGAGACTGAGAAGCAGGGAGG - Intergenic
1053271720 9:36754555-36754577 CTGGGCAATGAGATGGAGATAGG - Intergenic
1054296036 9:63333035-63333057 CTGGAGGGTGAGAAGAAGGTGGG + Intergenic
1056012875 9:82351052-82351074 ATGGATAATGAGTAGAAGGTAGG + Intergenic
1057339816 9:94190062-94190084 ATGGAAAATGAGAAGCAGGAGGG - Intergenic
1058171547 9:101687048-101687070 CTGGGTAAGGAGGAGGAAGTCGG + Exonic
1058286770 9:103188446-103188468 CTGCCTAATTAGAAGGAGGCAGG - Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1058632946 9:107008130-107008152 CTGCATAATGAGAGGGGGGTGGG - Intronic
1059269127 9:113061204-113061226 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059270263 9:113066653-113066675 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059271399 9:113072103-113072125 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059272530 9:113077547-113077569 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059273665 9:113082989-113083011 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059274801 9:113088435-113088457 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059934001 9:119289513-119289535 GTAGAAAATGAGAAGAAGGTAGG + Intronic
1060279078 9:122203964-122203986 CTGGATAATTAGGTGGGGGTAGG + Exonic
1060570313 9:124632899-124632921 CTGGATAATGAGAAAGTTGTGGG + Intronic
1060707301 9:125815848-125815870 ATCTACAATGAGAAGGAGGTAGG - Intronic
1061077981 9:128353343-128353365 CTGGACAATGAGGGGGAAGTGGG - Intronic
1061541617 9:131280532-131280554 CTGAAAAATGAGAAAGAGGAGGG + Intergenic
1061891933 9:133626537-133626559 CTGGGTAATGGGCAAGAGGTTGG - Intergenic
1062307211 9:135914755-135914777 CACGATCATGAGAGGGAGGTAGG + Intergenic
1187731942 X:22264282-22264304 CTGGAGAATGGGAGGGAGGATGG - Intergenic
1188029313 X:25246932-25246954 CGGGAAAATGACCAGGAGGTGGG + Intergenic
1189055399 X:37694386-37694408 GAGGAGATTGAGAAGGAGGTGGG + Exonic
1189353045 X:40291386-40291408 CAGGATAATGTGCTGGAGGTGGG - Intergenic
1190035168 X:47016144-47016166 CTGGCTAATGATATGTAGGTAGG - Intronic
1190467168 X:50736616-50736638 CTGGATAAAGAAAATGTGGTAGG - Intronic
1192843533 X:74882142-74882164 CTGGATAAAGAAAATGTGGTGGG + Intronic
1194673369 X:96764099-96764121 CTGGAAAATAAGAATGAGATAGG + Intronic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1196188816 X:112773534-112773556 CTGCAGAATAAGATGGAGGTGGG + Intergenic
1196486001 X:116207832-116207854 CTGGATAATCAGAAGTTGGGAGG + Intergenic
1198084733 X:133271245-133271267 TTTGATAATGAGAAGCAGGAAGG + Intergenic
1199907232 X:152245585-152245607 CTGGAGAATGGAAATGAGGTTGG - Intronic
1199922982 X:152429286-152429308 CTGGAGAAAGAGAGGGAGGGAGG - Intronic
1200709671 Y:6472242-6472264 CTGGAGCATGAGAAGGAGGCCGG - Intergenic
1201024441 Y:9692466-9692488 CTGGAGCATGAGAAGGAGGCCGG + Intergenic
1201613167 Y:15865750-15865772 TTGGAGAATGAGAATGAGCTTGG - Intergenic
1201782724 Y:17741265-17741287 CTGTATAATGAGAATTAAGTTGG + Intergenic
1201818829 Y:18164723-18164745 CTGTATAATGAGAATTAAGTTGG - Intergenic