ID: 1090779268

View in Genome Browser
Species Human (GRCh38)
Location 11:129992503-129992525
Sequence GGGTCCTGGCCACTTTGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 1, 2: 5, 3: 13, 4: 216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090779268 Original CRISPR GGGTCCTGGCCACTTTGCCT AGG (reversed) Intronic
900990473 1:6096158-6096180 GGGGCCAGGCCACGTTGCCCTGG - Intronic
901807962 1:11749723-11749745 GGCTCCTGGCCCCTGTGCCATGG - Intronic
901808991 1:11755210-11755232 GGCTCCAGGCCACTGTGCCATGG - Intergenic
901940864 1:12660618-12660640 GGGTCCTGCCCACTTAGCCTGGG - Intronic
903069247 1:20718343-20718365 AGGTCCTTGCCGCTTTTCCTAGG - Intergenic
903887288 1:26547806-26547828 GGATACTGACCACTTGGCCTGGG + Intronic
904675765 1:32198485-32198507 GGGTCTTGCCAACTTTGCCAAGG - Intergenic
904874357 1:33642896-33642918 GGCTCCTGGTCTCTCTGCCTTGG + Intronic
905120237 1:35676159-35676181 GGATACTGGGCACTTTGCCAGGG + Intergenic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
905930011 1:41780277-41780299 GGGCCTTGGCCACTCTGCCAAGG + Intronic
906421880 1:45675730-45675752 GGGTCTTGGCCATGTTGCCCAGG + Intronic
907388662 1:54142070-54142092 GGGCCCTGACCACATTCCCTGGG - Intronic
907442757 1:54488986-54489008 GTGTCCTGGCCCCTGGGCCTGGG + Intergenic
907726196 1:57023070-57023092 GGGTGCTCCCCACTTTGTCTGGG + Intronic
907929816 1:58988911-58988933 TTGTTCTGGCCACTGTGCCTGGG + Intergenic
910855370 1:91689707-91689729 CAGTCCTGGCCGCTGTGCCTGGG + Intronic
912555142 1:110510616-110510638 GGCTCCAGGCCACATTGCATTGG + Intergenic
912959304 1:114181124-114181146 GGTTCTTGGCCCCTTTGGCTGGG + Intergenic
912962782 1:114210782-114210804 TGGTCCTAACCACTTTGCTTAGG - Intergenic
913552450 1:119928938-119928960 GCCTCCTGGCCACTCTGCCTTGG - Intronic
918147999 1:181774786-181774808 TGCACCTGGCCACTTGGCCTGGG + Intronic
918590535 1:186236168-186236190 GGATCCTGGCCAGCTTGGCTGGG - Intergenic
919700815 1:200629338-200629360 GGCTCCAGGGCACATTGCCTGGG + Intronic
920065828 1:203268965-203268987 AGGCCCTGGTCACCTTGCCTAGG + Intronic
920334901 1:205238498-205238520 GTCTCCTGGTCACTTTCCCTAGG + Intronic
924284402 1:242470953-242470975 GAGACCTGGCCACATTGTCTTGG - Intronic
1062789697 10:294413-294435 GGGGTCTCGCCACATTGCCTAGG - Intronic
1063091877 10:2872751-2872773 AGATCCTGCCCACTTTGCCTAGG - Intergenic
1063923140 10:10951326-10951348 GGGTTCTTGCCACATTGCCCAGG + Intergenic
1063994940 10:11611063-11611085 GGGTCCTGCCCACTGGGGCTCGG + Intronic
1070789359 10:79180364-79180386 GGGTCCTGGCCCAGTAGCCTGGG + Intronic
1071567417 10:86678829-86678851 GGGTCTGGGCTCCTTTGCCTGGG + Intronic
1072950981 10:99846544-99846566 GGGTTCTTGCCATGTTGCCTAGG - Intronic
1075561532 10:123472207-123472229 GGGTCATGGCTACTTTGGCATGG - Intergenic
1075766670 10:124898824-124898846 AGGTCCTGGCCTCTGTTCCTTGG + Intergenic
1078840648 11:15073498-15073520 TAGTCCTGGCCACTTTGGATTGG + Intronic
1081615891 11:44591049-44591071 GGATCTTGGCCAGTGTGCCTGGG + Intronic
1082020143 11:47525886-47525908 GGGTTCTCGCCACATTGCCCAGG - Intronic
1083852933 11:65378459-65378481 CGGGCCTGGCCACTTAGCTTAGG + Intronic
1083942406 11:65903463-65903485 GGGACCCTGCCACTGTGCCTTGG + Intergenic
1084730670 11:71071524-71071546 TGGTCCTGGACATTTTGCCCTGG + Intronic
1084944422 11:72631105-72631127 GGGTCCTGGCTCCTTTGCAAGGG + Intronic
1085203193 11:74714098-74714120 GGGTGGTGGCCACTCTGCCTCGG - Intronic
1085507787 11:77069988-77070010 GGGACCTGGCCCCTTTGCCTTGG - Intronic
1089188976 11:116640783-116640805 GGGCCCTGGCTTCTTGGCCTGGG - Intergenic
1089741970 11:120590734-120590756 GGGTCCTTGCCTCTAGGCCTTGG + Intronic
1090481004 11:127068097-127068119 TGGTCCTGCCCACTTTTGCTTGG + Intergenic
1090731898 11:129579699-129579721 GGGTCCTGGCCCTTTTCTCTTGG - Intergenic
1090779268 11:129992503-129992525 GGGTCCTGGCCACTTTGCCTAGG - Intronic
1092244581 12:6856453-6856475 GAGGCCTGGCCCCTCTGCCTCGG + Intronic
1093982640 12:25491594-25491616 GTGTCCAGCCCACATTGCCTTGG - Intronic
1094862151 12:34479810-34479832 TGGTCCTGGACTCTTTTCCTTGG - Intergenic
1098150132 12:67538115-67538137 GGGCCCTGGTCACTTTTCCAAGG + Intergenic
1102011021 12:109618437-109618459 GGGTCTTGGAAGCTTTGCCTGGG + Intergenic
1102134285 12:110559917-110559939 GGGTCCTCGCCATGTTGCCCAGG + Intronic
1102467569 12:113138873-113138895 GGGTCCTGGGGACATTGCCCAGG + Intergenic
1104378315 12:128284942-128284964 GGGTTCTCACCACATTGCCTAGG - Intronic
1104689675 12:130816083-130816105 AAGGCCTGGCCACTGTGCCTGGG + Intronic
1104797209 12:131528115-131528137 CCGTCCTGGCCACATTGACTGGG - Intergenic
1106093601 13:26621989-26622011 GGGCCCTGGCTACTTTTGCTTGG + Intronic
1113439262 13:110314986-110315008 GGCTCCAGGCCCCTTTCCCTTGG - Intronic
1114550185 14:23528290-23528312 GGCTCCTCCCCACTTTCCCTTGG + Intronic
1115370579 14:32609500-32609522 GGTTCCAGGCCATTTTGCATTGG + Intronic
1117281464 14:54245592-54245614 GCGACCTTGACACTTTGCCTGGG + Intergenic
1117459477 14:55930700-55930722 GGGTTCTCGCCATGTTGCCTTGG + Intergenic
1117511124 14:56452653-56452675 CAGTCCTTGCCACTTTTCCTAGG - Intergenic
1119329325 14:73782519-73782541 GGGGTCTTGCCACATTGCCTAGG + Intronic
1119350965 14:73965348-73965370 GTGGTCTGGCCCCTTTGCCTTGG - Exonic
1119712417 14:76831668-76831690 TGGGCCTGGTCACTTTTCCTGGG - Intronic
1121105707 14:91278126-91278148 GGGACCTGGCCACTTTGCCCCGG - Exonic
1122839264 14:104447109-104447131 GGCTCCTGGCAAGTTTGACTTGG - Intergenic
1124203474 15:27698104-27698126 GGGAGCTGCCCATTTTGCCTGGG - Intergenic
1128697885 15:69781953-69781975 GGCTCCCAGCCATTTTGCCTGGG + Intergenic
1128801499 15:70499942-70499964 GGCTCCTGGCCACCTGGCTTGGG - Intergenic
1128996954 15:72304474-72304496 GGGTTCTTGCCACTTACCCTTGG - Intronic
1129543948 15:76375033-76375055 GGGGCTTTGCCACATTGCCTAGG - Intronic
1130011749 15:80157770-80157792 TGGTCCTAGCCACTTAACCTGGG - Intronic
1132330999 15:101012630-101012652 GTGGCCTGGGCACTCTGCCTGGG - Intronic
1133872271 16:9700419-9700441 GGGTCCTGGACACTTGGTCTTGG + Intergenic
1135886784 16:26317266-26317288 AGGTGCTGGCCACCTTACCTTGG + Intergenic
1138633650 16:58319456-58319478 GGCTCCAGGCAGCTTTGCCTGGG + Intronic
1139093518 16:63677248-63677270 GGATCCTGTCCACTCTGCCAGGG - Intergenic
1139752800 16:69119695-69119717 GGGCCCAGGCCACTTGGTCTTGG + Exonic
1143368597 17:6424311-6424333 GGGTCCTGGGGTCTTTGCCACGG - Exonic
1144028644 17:11300764-11300786 GGTTCCTGGCCAGTATGCCGGGG - Intronic
1145211160 17:21014146-21014168 GTGGCCTGGCCACATGGCCTTGG - Intronic
1145267175 17:21385514-21385536 GGGACCTGGCCGCTCTGACTGGG - Intronic
1145910405 17:28538927-28538949 GTGGCCTGGCCATTTTGCTTAGG - Intronic
1148344020 17:46891404-46891426 GGGCCCTGGCGACCTTGCTTTGG - Intergenic
1148766663 17:50043679-50043701 GGGTCTTGTCCTGTTTGCCTCGG - Intergenic
1149874249 17:60215161-60215183 GGGTCTTGGCCATATTGCCCTGG + Intronic
1150088034 17:62292412-62292434 GGGTCTTGGCCATGTTGCCCTGG + Intergenic
1150635302 17:66908942-66908964 GGGTCCTTCCCACCTTCCCTGGG + Intergenic
1151701073 17:75742837-75742859 GCGACCTGGCCACGTGGCCTGGG + Intronic
1151768147 17:76142690-76142712 GGGTCCTGCCCACCTCACCTGGG - Exonic
1152238487 17:79150278-79150300 GGGCCCAGGCCACTCTGCTTGGG + Intronic
1152737592 17:82004990-82005012 GGGTCTGGGCCTCTTTGCATCGG + Intronic
1154465168 18:14637305-14637327 GGGTCCGTGGGACTTTGCCTTGG + Intergenic
1157174518 18:45439091-45439113 GGCACCTGGCCATATTGCCTAGG - Intronic
1157408136 18:47440963-47440985 GGGTCCTGACAACTTGGCCTTGG - Intergenic
1159184875 18:64956719-64956741 GGCTCCAGGCCACTTTACCCAGG - Intergenic
1160560730 18:79754320-79754342 GGGTCCACGCCACGTGGCCTGGG + Exonic
1160683160 19:421725-421747 GGGGCCTTGCCACGTTGCCCAGG - Intronic
1162306560 19:9878040-9878062 GGGGTCTGGCCACATTGCCCAGG + Intronic
1163852216 19:19670563-19670585 GGGGTCTCGCCACTTTGCCCAGG - Intronic
1164283601 19:23790734-23790756 GGGTCCTGGCGTCTTTGCTGTGG - Intronic
1164672224 19:30078597-30078619 GGGTCCTGACCACCTTACCTTGG - Intergenic
1166933106 19:46313429-46313451 GGGTCCTAACCACTTTGCCCAGG - Intronic
1167627708 19:50603700-50603722 TGGTCCTCTCCCCTTTGCCTCGG + Intergenic
1167628067 19:50605594-50605616 TGGTCCTCTCCCCTTTGCCTCGG + Intergenic
1167698733 19:51029969-51029991 GAGTCCTGCCCACCTTCCCTGGG - Intronic
1168044188 19:53782267-53782289 GGGTCTTGGCCATGTTGCCCAGG - Intergenic
925329340 2:3046626-3046648 GGGTGCTGGCCACTCATCCTGGG - Intergenic
926147687 2:10406623-10406645 GAGTCCTGGCCACAGAGCCTGGG - Intronic
927649122 2:24900594-24900616 TGGTCCTGGGCACTTTCTCTAGG - Intronic
927884819 2:26711915-26711937 GGGTCCTGGGGAGATTGCCTGGG + Intronic
929115566 2:38441184-38441206 GGCTCCTGGCCAACTTGCTTTGG - Intergenic
930286973 2:49442642-49442664 GGCTCTTGGCCACATTGTCTAGG + Intergenic
930784358 2:55256888-55256910 GGGTTCTTGCCATTTTGCCCAGG + Intronic
933078058 2:77954381-77954403 TGGTCCTCTCCCCTTTGCCTCGG - Intergenic
936403768 2:112184981-112185003 GGATCCTGTCCTCTTTCCCTGGG - Intronic
937294808 2:120803655-120803677 GGCTCCTGGCCTCTCTGACTTGG + Intronic
938560304 2:132466605-132466627 GGGTCCAGGCCTGTTAGCCTGGG - Intronic
942683332 2:178503362-178503384 GGGTCTTGGTTTCTTTGCCTAGG + Intronic
943334880 2:186601262-186601284 GGGGTCTCGCCACATTGCCTAGG - Intronic
943820656 2:192315699-192315721 GGGACCTGCCCACTCTGCCCAGG + Intergenic
944409184 2:199420479-199420501 GGATGCTGGCCACATTGTCTTGG - Intronic
946414311 2:219531943-219531965 GGGGCCTGGGCCCTCTGCCTGGG + Intronic
948248156 2:236503770-236503792 GGGACCTGGGCACCATGCCTCGG + Intronic
1168736894 20:148192-148214 GGGCCCTGCCCACTGGGCCTTGG + Intergenic
1170208259 20:13822736-13822758 GCTTCCTGTCCACTTTGCCTTGG - Intergenic
1170615896 20:17950687-17950709 GGAACATGGCCACTTAGCCTTGG + Intronic
1172133952 20:32674838-32674860 GGGATCTTGCCATTTTGCCTAGG + Intergenic
1172305275 20:33876176-33876198 GGGCCCTGCCCACTTGCCCTTGG + Intergenic
1174846577 20:53948815-53948837 ACGGCCTGGCCACTTTGACTTGG + Intronic
1176269900 20:64230867-64230889 GGGTCCTGGCCGAGTTGGCTGGG + Intronic
1178507489 21:33174464-33174486 GGGTTCTTGCCACGTTGCCCAGG - Intergenic
1179727221 21:43347283-43347305 GGGTCCCAGCCACATGGCCTGGG - Intergenic
1182070660 22:27461523-27461545 GGGTCCTGGCCACCTTGCCTGGG + Intergenic
1184739155 22:46417176-46417198 GGGTCTTGCCCACATTTCCTGGG - Intronic
1184982840 22:48106475-48106497 GGGCTCTGGCCACTCTGCCTCGG + Intergenic
952942139 3:38453641-38453663 GGCTCCTGACCACTTTGCCCGGG - Intergenic
953298177 3:41742543-41742565 ACGTCCTGGACATTTTGCCTAGG - Intronic
953462428 3:43092487-43092509 GGGGTCTGGCCATGTTGCCTAGG + Intronic
953486539 3:43303269-43303291 GGGTCGAGGCCATTTTGCCGTGG + Exonic
953570087 3:44064461-44064483 GGGTCCTTACCACTGTGGCTGGG - Intergenic
953930646 3:47004201-47004223 GGGTCGTGCCCACCTTGCATGGG - Exonic
954637617 3:52079766-52079788 CTTTCCTGGCCACTTTGCCCAGG - Intronic
956849981 3:73220066-73220088 TGGTCATGGCCACTTGGCTTTGG + Intergenic
958746959 3:98148050-98148072 GGGTCCTGGTAATTCTGCCTTGG + Intergenic
961404394 3:126668061-126668083 GGGTCCTGTCCCCAGTGCCTGGG + Intergenic
961492430 3:127264979-127265001 GGGCCCTAGCCACGTTGCATGGG + Intergenic
961769856 3:129241151-129241173 GGGTTCTTGCCATCTTGCCTAGG + Intergenic
962230971 3:133665120-133665142 GGGTTCTTGCTACGTTGCCTAGG - Intergenic
962286866 3:134093594-134093616 GTTGCCTGGCCCCTTTGCCTTGG + Intronic
967557687 3:190877394-190877416 TGGTCCTCTCCCCTTTGCCTCGG - Intronic
969496892 4:7531385-7531407 CAGTCCTGGGCACTCTGCCTGGG - Intronic
969787866 4:9473517-9473539 GGGTCCCGGCCCCTCTGCCATGG - Intergenic
973705271 4:53574663-53574685 GGGCTCTGGACACTTTGCCTGGG + Intronic
974012859 4:56623431-56623453 GGCTCTTGGCCTCATTGCCTTGG - Intergenic
975747949 4:77492970-77492992 GGGTCCTTTCCAGGTTGCCTTGG + Intergenic
975758436 4:77594564-77594586 GAGCCCAGGCCACTGTGCCTGGG - Intronic
976660006 4:87530917-87530939 GGAAACTGGGCACTTTGCCTAGG + Intronic
984096204 4:175437942-175437964 GGGTTCTTGCCCCTTTGCCCAGG - Intergenic
985721322 5:1490723-1490745 GTGCCGTGGCCACGTTGCCTTGG - Intronic
986548304 5:8924097-8924119 GGGTCCTCGCAACTTTGCCTGGG - Intergenic
987759512 5:22142317-22142339 GGGTACTGGCCTCATTGTCTAGG + Intronic
990096211 5:52117117-52117139 GAGTCCTGGCCACTTTGTCTAGG + Intergenic
991208862 5:64081762-64081784 AGGTCCTAGTCAATTTGCCTAGG + Intergenic
992840781 5:80690108-80690130 GGGTTCTGGCTATTTTGCCCAGG + Intronic
992907121 5:81357521-81357543 AGGTGCTGGCCAGTTTGCCCCGG - Intronic
997271277 5:132540424-132540446 CGGTCCTGACCACCATGCCTGGG + Intergenic
997866366 5:137467076-137467098 GGTTCCTTGCCACATGGCCTAGG + Intronic
998250336 5:140548125-140548147 GGGCCCTGGCCCCTATTCCTAGG - Intronic
998429501 5:142058734-142058756 GGGCCCTGCCCACTTTCCCTTGG - Intergenic
1004307286 6:14512496-14512518 GGCTACTGGTCACTTTGCCAAGG - Intergenic
1004416159 6:15426109-15426131 GAGTACTGGGCAGTTTGCCTTGG + Intronic
1005288088 6:24350370-24350392 GGGTCCTACCCACTGTGGCTGGG - Intronic
1006661037 6:35644830-35644852 GGGTCCTGGACTGTATGCCTGGG + Intronic
1008609367 6:53171763-53171785 GGGGCCTTGCCATGTTGCCTAGG - Intergenic
1009600842 6:65796280-65796302 GGATCCTGGCCACTTTCATTTGG - Intergenic
1011217856 6:85024422-85024444 GGGTGGTGGCCACTTTGCAGAGG - Intergenic
1013435354 6:110099416-110099438 GGGTTCTCGCCATGTTGCCTGGG + Intergenic
1018060261 6:160084561-160084583 TGGTCCTGACCACTCTGCGTGGG + Intronic
1018183329 6:161243407-161243429 CAGTCCTGACCACGTTGCCTTGG - Intronic
1019551015 7:1602576-1602598 GGTTCCTGTCCACGTGGCCTGGG + Intergenic
1019639814 7:2097324-2097346 GAGTCCTGTCCACTTGGTCTTGG - Intronic
1026476853 7:70743853-70743875 TGGCCATGGTCACTTTGCCTGGG + Intronic
1027240662 7:76325957-76325979 GGGGTCTGGCCATGTTGCCTAGG - Intergenic
1027394683 7:77742136-77742158 GGGTTCTTGCCACGTTGCCCAGG - Intronic
1029226777 7:99034202-99034224 GGGCCCTGGCCACTCTGCCCGGG + Intronic
1029725652 7:102402244-102402266 GGGGTCTTGCCACGTTGCCTGGG - Intronic
1029981063 7:104879526-104879548 GGGATCTTGCCACATTGCCTAGG - Intronic
1031922992 7:127614936-127614958 GTGTCCAGCCCTCTTTGCCTGGG - Exonic
1032675965 7:134129664-134129686 GGGGCCTTGCCATATTGCCTAGG + Intronic
1033654992 7:143367141-143367163 GGGTCCTGGCCATTGTGCTGGGG + Intergenic
1035240762 7:157527799-157527821 GGGTCCTGCACACATTGCTTCGG - Intergenic
1035434583 7:158849973-158849995 GGGGCCTGGCCCTTTTGCCCAGG + Intergenic
1035647980 8:1243029-1243051 GGGAGCTGGCAAGTTTGCCTAGG - Intergenic
1036217518 8:6892977-6892999 GGGGCTTGGCCACCATGCCTGGG + Intergenic
1038006978 8:23439662-23439684 GAGTTCTTCCCACTTTGCCTGGG + Intronic
1040012955 8:42677438-42677460 GGGTCCTGGCCTCTGTTGCTGGG - Intergenic
1045019286 8:98027714-98027736 GGGGCCTGGCCCCTTCTCCTTGG - Exonic
1046863787 8:119123734-119123756 ACATCCTGGACACTTTGCCTTGG - Intergenic
1047297591 8:123584926-123584948 GGGCTCTGACCAGTTTGCCTGGG + Intergenic
1047427329 8:124758565-124758587 GGGATATGGTCACTTTGCCTGGG - Intergenic
1049280657 8:141742497-141742519 TGCTCCTGGCCTCATTGCCTTGG - Intergenic
1049343103 8:142124286-142124308 GAGTCCTGCCCACCTGGCCTGGG + Intergenic
1049399543 8:142418774-142418796 ATGCCATGGCCACTTTGCCTGGG - Intergenic
1050306269 9:4308615-4308637 GGGGCCTGGCAAGTTTCCCTGGG - Intronic
1051405574 9:16734516-16734538 TGGTTCTGGCCACCTTGACTGGG + Intronic
1051490292 9:17655880-17655902 GGGTCCAGGTCACTTTGCACAGG + Intronic
1056067441 9:82951411-82951433 GGGTCTTGTGCACTTTGACTGGG - Intergenic
1056828332 9:89891964-89891986 GTTACCAGGCCACTTTGCCTTGG + Intergenic
1057291143 9:93808270-93808292 AGGTCCTGGCCAAGTGGCCTTGG - Intergenic
1057506863 9:95641709-95641731 GTGTACTGGGCACTTTGCCAGGG + Intergenic
1057778399 9:98029294-98029316 GGGATCTTGCCACATTGCCTAGG - Intergenic
1057928160 9:99170956-99170978 GGGTCCTGCCCACTTGACCCTGG + Intergenic
1058723960 9:107784517-107784539 GGGTCTTGGCCAGCTCGCCTGGG + Intergenic
1059107961 9:111527691-111527713 AGTTCCTGACCATTTTGCCTGGG + Exonic
1062079972 9:134618671-134618693 GGGCCCTGGCCGCTTTGCTGAGG + Intergenic
1062082333 9:134630622-134630644 GGGTCCTGGCTCCTTCACCTGGG + Intergenic
1062239480 9:135527961-135527983 GCGTCCTCCCCACTGTGCCTCGG + Intergenic
1062285184 9:135769673-135769695 AGGCCCTGGCCCCTGTGCCTTGG - Intronic
1203361616 Un_KI270442v1:221919-221941 GGGGCCTGGCCACTGTACGTGGG + Intergenic
1185781988 X:2855732-2855754 GGGGTCTTGCCACGTTGCCTAGG - Intronic
1185884886 X:3773615-3773637 GGGTTCTCACCACGTTGCCTAGG + Intergenic
1187447381 X:19371687-19371709 GGGTCCTGGCCCCTTCTCCCTGG + Intronic
1189238353 X:39506314-39506336 GGGGGCTGGGCACTGTGCCTTGG - Intergenic
1189270239 X:39746438-39746460 GTGTGCTGGGCACTGTGCCTGGG - Intergenic
1189292195 X:39894480-39894502 GGTGCCTGGCCACTTTGCTCAGG - Intergenic
1192209980 X:69121777-69121799 GGGGCTGGGCCACTGTGCCTGGG - Intergenic
1193856771 X:86612171-86612193 GGGGCCTTGCCACTCTGTCTGGG + Intronic
1195371968 X:104185096-104185118 GGGGTCTCGCCACATTGCCTAGG + Intronic
1195386948 X:104322629-104322651 GGGACCTTGCTATTTTGCCTAGG + Intergenic