ID: 1090780248

View in Genome Browser
Species Human (GRCh38)
Location 11:130001823-130001845
Sequence CTGCGCTGCACCCTGGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3197
Summary {0: 1, 1: 0, 2: 5, 3: 182, 4: 3009}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090780236_1090780248 12 Left 1090780236 11:130001788-130001810 CCCTCTCCCGAGCGCCGACCGGC 0: 1
1: 0
2: 1
3: 9
4: 56
Right 1090780248 11:130001823-130001845 CTGCGCTGCACCCTGGGTGCAGG 0: 1
1: 0
2: 5
3: 182
4: 3009
1090780239_1090780248 5 Left 1090780239 11:130001795-130001817 CCGAGCGCCGACCGGCCTCGCCC 0: 1
1: 0
2: 1
3: 19
4: 170
Right 1090780248 11:130001823-130001845 CTGCGCTGCACCCTGGGTGCAGG 0: 1
1: 0
2: 5
3: 182
4: 3009
1090780242_1090780248 -10 Left 1090780242 11:130001810-130001832 CCTCGCCCTGCCTCTGCGCTGCA 0: 1
1: 0
2: 3
3: 44
4: 478
Right 1090780248 11:130001823-130001845 CTGCGCTGCACCCTGGGTGCAGG 0: 1
1: 0
2: 5
3: 182
4: 3009
1090780234_1090780248 19 Left 1090780234 11:130001781-130001803 CCATCAGCCCTCTCCCGAGCGCC 0: 1
1: 0
2: 1
3: 21
4: 227
Right 1090780248 11:130001823-130001845 CTGCGCTGCACCCTGGGTGCAGG 0: 1
1: 0
2: 5
3: 182
4: 3009
1090780240_1090780248 -2 Left 1090780240 11:130001802-130001824 CCGACCGGCCTCGCCCTGCCTCT 0: 1
1: 0
2: 1
3: 31
4: 359
Right 1090780248 11:130001823-130001845 CTGCGCTGCACCCTGGGTGCAGG 0: 1
1: 0
2: 5
3: 182
4: 3009
1090780238_1090780248 6 Left 1090780238 11:130001794-130001816 CCCGAGCGCCGACCGGCCTCGCC 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1090780248 11:130001823-130001845 CTGCGCTGCACCCTGGGTGCAGG 0: 1
1: 0
2: 5
3: 182
4: 3009
1090780237_1090780248 11 Left 1090780237 11:130001789-130001811 CCTCTCCCGAGCGCCGACCGGCC 0: 1
1: 0
2: 2
3: 8
4: 136
Right 1090780248 11:130001823-130001845 CTGCGCTGCACCCTGGGTGCAGG 0: 1
1: 0
2: 5
3: 182
4: 3009
1090780241_1090780248 -6 Left 1090780241 11:130001806-130001828 CCGGCCTCGCCCTGCCTCTGCGC 0: 1
1: 0
2: 7
3: 70
4: 688
Right 1090780248 11:130001823-130001845 CTGCGCTGCACCCTGGGTGCAGG 0: 1
1: 0
2: 5
3: 182
4: 3009

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090780248 Original CRISPR CTGCGCTGCACCCTGGGTGC AGG Intronic
Too many off-targets to display for this crispr