ID: 1090780379

View in Genome Browser
Species Human (GRCh38)
Location 11:130002187-130002209
Sequence GCGCTCCGGGCGCGGCGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 554
Summary {0: 1, 1: 0, 2: 5, 3: 74, 4: 474}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090780379_1090780385 -2 Left 1090780379 11:130002187-130002209 CCTGCCCGCCGCGCCCGGAGCGC 0: 1
1: 0
2: 5
3: 74
4: 474
Right 1090780385 11:130002208-130002230 GCCCGCGCAACCGCCGCCGCCGG 0: 1
1: 1
2: 0
3: 34
4: 283
1090780379_1090780393 28 Left 1090780379 11:130002187-130002209 CCTGCCCGCCGCGCCCGGAGCGC 0: 1
1: 0
2: 5
3: 74
4: 474
Right 1090780393 11:130002238-130002260 AGGCCGCCCAACCGCCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 55
1090780379_1090780389 8 Left 1090780379 11:130002187-130002209 CCTGCCCGCCGCGCCCGGAGCGC 0: 1
1: 0
2: 5
3: 74
4: 474
Right 1090780389 11:130002218-130002240 CCGCCGCCGCCGGAGCGCGCAGG 0: 1
1: 0
2: 5
3: 62
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090780379 Original CRISPR GCGCTCCGGGCGCGGCGGGC AGG (reversed) Intronic