ID: 1090780382

View in Genome Browser
Species Human (GRCh38)
Location 11:130002195-130002217
Sequence TTGCGCGGGCGCTCCGGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090780382_1090780393 20 Left 1090780382 11:130002195-130002217 CCGCGCCCGGAGCGCCCGCGCAA 0: 1
1: 0
2: 1
3: 7
4: 73
Right 1090780393 11:130002238-130002260 AGGCCGCCCAACCGCCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 55
1090780382_1090780389 0 Left 1090780382 11:130002195-130002217 CCGCGCCCGGAGCGCCCGCGCAA 0: 1
1: 0
2: 1
3: 7
4: 73
Right 1090780389 11:130002218-130002240 CCGCCGCCGCCGGAGCGCGCAGG 0: 1
1: 0
2: 5
3: 62
4: 356
1090780382_1090780385 -10 Left 1090780382 11:130002195-130002217 CCGCGCCCGGAGCGCCCGCGCAA 0: 1
1: 0
2: 1
3: 7
4: 73
Right 1090780385 11:130002208-130002230 GCCCGCGCAACCGCCGCCGCCGG 0: 1
1: 1
2: 0
3: 34
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090780382 Original CRISPR TTGCGCGGGCGCTCCGGGCG CGG (reversed) Intronic