ID: 1090780383

View in Genome Browser
Species Human (GRCh38)
Location 11:130002200-130002222
Sequence GGCGGTTGCGCGGGCGCTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090780383_1090780393 15 Left 1090780383 11:130002200-130002222 CCCGGAGCGCCCGCGCAACCGCC 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1090780393 11:130002238-130002260 AGGCCGCCCAACCGCCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 55
1090780383_1090780400 30 Left 1090780383 11:130002200-130002222 CCCGGAGCGCCCGCGCAACCGCC 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1090780400 11:130002253-130002275 CGTCCCGGCCCAACCAACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 37
1090780383_1090780399 29 Left 1090780383 11:130002200-130002222 CCCGGAGCGCCCGCGCAACCGCC 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1090780399 11:130002252-130002274 CCGTCCCGGCCCAACCAACGCGG 0: 1
1: 0
2: 0
3: 2
4: 28
1090780383_1090780389 -5 Left 1090780383 11:130002200-130002222 CCCGGAGCGCCCGCGCAACCGCC 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1090780389 11:130002218-130002240 CCGCCGCCGCCGGAGCGCGCAGG 0: 1
1: 0
2: 5
3: 62
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090780383 Original CRISPR GGCGGTTGCGCGGGCGCTCC GGG (reversed) Intronic