ID: 1090780385

View in Genome Browser
Species Human (GRCh38)
Location 11:130002208-130002230
Sequence GCCCGCGCAACCGCCGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 1, 2: 0, 3: 34, 4: 283}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090780382_1090780385 -10 Left 1090780382 11:130002195-130002217 CCGCGCCCGGAGCGCCCGCGCAA 0: 1
1: 0
2: 1
3: 7
4: 73
Right 1090780385 11:130002208-130002230 GCCCGCGCAACCGCCGCCGCCGG 0: 1
1: 1
2: 0
3: 34
4: 283
1090780370_1090780385 28 Left 1090780370 11:130002157-130002179 CCCCGGTGCTCGGCTCCCGGCCG 0: 1
1: 0
2: 0
3: 12
4: 156
Right 1090780385 11:130002208-130002230 GCCCGCGCAACCGCCGCCGCCGG 0: 1
1: 1
2: 0
3: 34
4: 283
1090780376_1090780385 12 Left 1090780376 11:130002173-130002195 CCGGCCGGCGGAGACCTGCCCGC 0: 1
1: 0
2: 0
3: 8
4: 122
Right 1090780385 11:130002208-130002230 GCCCGCGCAACCGCCGCCGCCGG 0: 1
1: 1
2: 0
3: 34
4: 283
1090780371_1090780385 27 Left 1090780371 11:130002158-130002180 CCCGGTGCTCGGCTCCCGGCCGG 0: 1
1: 0
2: 1
3: 14
4: 166
Right 1090780385 11:130002208-130002230 GCCCGCGCAACCGCCGCCGCCGG 0: 1
1: 1
2: 0
3: 34
4: 283
1090780375_1090780385 13 Left 1090780375 11:130002172-130002194 CCCGGCCGGCGGAGACCTGCCCG 0: 1
1: 0
2: 1
3: 12
4: 167
Right 1090780385 11:130002208-130002230 GCCCGCGCAACCGCCGCCGCCGG 0: 1
1: 1
2: 0
3: 34
4: 283
1090780369_1090780385 29 Left 1090780369 11:130002156-130002178 CCCCCGGTGCTCGGCTCCCGGCC 0: 1
1: 0
2: 2
3: 18
4: 172
Right 1090780385 11:130002208-130002230 GCCCGCGCAACCGCCGCCGCCGG 0: 1
1: 1
2: 0
3: 34
4: 283
1090780381_1090780385 -7 Left 1090780381 11:130002192-130002214 CCGCCGCGCCCGGAGCGCCCGCG 0: 1
1: 1
2: 4
3: 53
4: 382
Right 1090780385 11:130002208-130002230 GCCCGCGCAACCGCCGCCGCCGG 0: 1
1: 1
2: 0
3: 34
4: 283
1090780380_1090780385 -6 Left 1090780380 11:130002191-130002213 CCCGCCGCGCCCGGAGCGCCCGC 0: 1
1: 3
2: 12
3: 55
4: 468
Right 1090780385 11:130002208-130002230 GCCCGCGCAACCGCCGCCGCCGG 0: 1
1: 1
2: 0
3: 34
4: 283
1090780379_1090780385 -2 Left 1090780379 11:130002187-130002209 CCTGCCCGCCGCGCCCGGAGCGC 0: 1
1: 0
2: 5
3: 74
4: 474
Right 1090780385 11:130002208-130002230 GCCCGCGCAACCGCCGCCGCCGG 0: 1
1: 1
2: 0
3: 34
4: 283
1090780377_1090780385 8 Left 1090780377 11:130002177-130002199 CCGGCGGAGACCTGCCCGCCGCG 0: 1
1: 0
2: 2
3: 12
4: 238
Right 1090780385 11:130002208-130002230 GCCCGCGCAACCGCCGCCGCCGG 0: 1
1: 1
2: 0
3: 34
4: 283
1090780373_1090780385 26 Left 1090780373 11:130002159-130002181 CCGGTGCTCGGCTCCCGGCCGGC 0: 1
1: 0
2: 1
3: 16
4: 142
Right 1090780385 11:130002208-130002230 GCCCGCGCAACCGCCGCCGCCGG 0: 1
1: 1
2: 0
3: 34
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090780385 Original CRISPR GCCCGCGCAACCGCCGCCGC CGG Intronic