ID: 1090780388

View in Genome Browser
Species Human (GRCh38)
Location 11:130002218-130002240
Sequence CCTGCGCGCTCCGGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 235}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090780388_1090780393 -3 Left 1090780388 11:130002218-130002240 CCGCCGCCGCCGGAGCGCGCAGG 0: 1
1: 0
2: 2
3: 27
4: 235
Right 1090780393 11:130002238-130002260 AGGCCGCCCAACCGCCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 55
1090780388_1090780400 12 Left 1090780388 11:130002218-130002240 CCGCCGCCGCCGGAGCGCGCAGG 0: 1
1: 0
2: 2
3: 27
4: 235
Right 1090780400 11:130002253-130002275 CGTCCCGGCCCAACCAACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 37
1090780388_1090780405 18 Left 1090780388 11:130002218-130002240 CCGCCGCCGCCGGAGCGCGCAGG 0: 1
1: 0
2: 2
3: 27
4: 235
Right 1090780405 11:130002259-130002281 GGCCCAACCAACGCGGGCAGGGG 0: 1
1: 0
2: 0
3: 1
4: 125
1090780388_1090780403 16 Left 1090780388 11:130002218-130002240 CCGCCGCCGCCGGAGCGCGCAGG 0: 1
1: 0
2: 2
3: 27
4: 235
Right 1090780403 11:130002257-130002279 CCGGCCCAACCAACGCGGGCAGG 0: 1
1: 0
2: 0
3: 1
4: 39
1090780388_1090780408 21 Left 1090780388 11:130002218-130002240 CCGCCGCCGCCGGAGCGCGCAGG 0: 1
1: 0
2: 2
3: 27
4: 235
Right 1090780408 11:130002262-130002284 CCAACCAACGCGGGCAGGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 83
1090780388_1090780410 26 Left 1090780388 11:130002218-130002240 CCGCCGCCGCCGGAGCGCGCAGG 0: 1
1: 0
2: 2
3: 27
4: 235
Right 1090780410 11:130002267-130002289 CAACGCGGGCAGGGGAGGAGAGG 0: 1
1: 0
2: 1
3: 22
4: 328
1090780388_1090780404 17 Left 1090780388 11:130002218-130002240 CCGCCGCCGCCGGAGCGCGCAGG 0: 1
1: 0
2: 2
3: 27
4: 235
Right 1090780404 11:130002258-130002280 CGGCCCAACCAACGCGGGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 16
1090780388_1090780399 11 Left 1090780388 11:130002218-130002240 CCGCCGCCGCCGGAGCGCGCAGG 0: 1
1: 0
2: 2
3: 27
4: 235
Right 1090780399 11:130002252-130002274 CCGTCCCGGCCCAACCAACGCGG 0: 1
1: 0
2: 0
3: 2
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090780388 Original CRISPR CCTGCGCGCTCCGGCGGCGG CGG (reversed) Intronic