ID: 1090780389

View in Genome Browser
Species Human (GRCh38)
Location 11:130002218-130002240
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 5, 3: 62, 4: 356}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090780377_1090780389 18 Left 1090780377 11:130002177-130002199 CCGGCGGAGACCTGCCCGCCGCG 0: 1
1: 0
2: 2
3: 12
4: 238
Right 1090780389 11:130002218-130002240 CCGCCGCCGCCGGAGCGCGCAGG 0: 1
1: 0
2: 5
3: 62
4: 356
1090780375_1090780389 23 Left 1090780375 11:130002172-130002194 CCCGGCCGGCGGAGACCTGCCCG 0: 1
1: 0
2: 1
3: 12
4: 167
Right 1090780389 11:130002218-130002240 CCGCCGCCGCCGGAGCGCGCAGG 0: 1
1: 0
2: 5
3: 62
4: 356
1090780376_1090780389 22 Left 1090780376 11:130002173-130002195 CCGGCCGGCGGAGACCTGCCCGC 0: 1
1: 0
2: 0
3: 8
4: 122
Right 1090780389 11:130002218-130002240 CCGCCGCCGCCGGAGCGCGCAGG 0: 1
1: 0
2: 5
3: 62
4: 356
1090780383_1090780389 -5 Left 1090780383 11:130002200-130002222 CCCGGAGCGCCCGCGCAACCGCC 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1090780389 11:130002218-130002240 CCGCCGCCGCCGGAGCGCGCAGG 0: 1
1: 0
2: 5
3: 62
4: 356
1090780384_1090780389 -6 Left 1090780384 11:130002201-130002223 CCGGAGCGCCCGCGCAACCGCCG 0: 1
1: 0
2: 0
3: 11
4: 101
Right 1090780389 11:130002218-130002240 CCGCCGCCGCCGGAGCGCGCAGG 0: 1
1: 0
2: 5
3: 62
4: 356
1090780380_1090780389 4 Left 1090780380 11:130002191-130002213 CCCGCCGCGCCCGGAGCGCCCGC 0: 1
1: 3
2: 12
3: 55
4: 468
Right 1090780389 11:130002218-130002240 CCGCCGCCGCCGGAGCGCGCAGG 0: 1
1: 0
2: 5
3: 62
4: 356
1090780381_1090780389 3 Left 1090780381 11:130002192-130002214 CCGCCGCGCCCGGAGCGCCCGCG 0: 1
1: 1
2: 4
3: 53
4: 382
Right 1090780389 11:130002218-130002240 CCGCCGCCGCCGGAGCGCGCAGG 0: 1
1: 0
2: 5
3: 62
4: 356
1090780379_1090780389 8 Left 1090780379 11:130002187-130002209 CCTGCCCGCCGCGCCCGGAGCGC 0: 1
1: 0
2: 5
3: 74
4: 474
Right 1090780389 11:130002218-130002240 CCGCCGCCGCCGGAGCGCGCAGG 0: 1
1: 0
2: 5
3: 62
4: 356
1090780382_1090780389 0 Left 1090780382 11:130002195-130002217 CCGCGCCCGGAGCGCCCGCGCAA 0: 1
1: 0
2: 1
3: 7
4: 73
Right 1090780389 11:130002218-130002240 CCGCCGCCGCCGGAGCGCGCAGG 0: 1
1: 0
2: 5
3: 62
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type