ID: 1090780391

View in Genome Browser
Species Human (GRCh38)
Location 11:130002224-130002246
Sequence GGGCGGCCTGCGCGCTCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 123}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090780391_1090780411 29 Left 1090780391 11:130002224-130002246 CCGCCGGAGCGCGCAGGCCGCCC 0: 1
1: 0
2: 1
3: 16
4: 123
Right 1090780411 11:130002276-130002298 CAGGGGAGGAGAGGTGCGCGCGG 0: 1
1: 1
2: 1
3: 27
4: 490
1090780391_1090780393 -9 Left 1090780391 11:130002224-130002246 CCGCCGGAGCGCGCAGGCCGCCC 0: 1
1: 0
2: 1
3: 16
4: 123
Right 1090780393 11:130002238-130002260 AGGCCGCCCAACCGCCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 55
1090780391_1090780399 5 Left 1090780391 11:130002224-130002246 CCGCCGGAGCGCGCAGGCCGCCC 0: 1
1: 0
2: 1
3: 16
4: 123
Right 1090780399 11:130002252-130002274 CCGTCCCGGCCCAACCAACGCGG 0: 1
1: 0
2: 0
3: 2
4: 28
1090780391_1090780400 6 Left 1090780391 11:130002224-130002246 CCGCCGGAGCGCGCAGGCCGCCC 0: 1
1: 0
2: 1
3: 16
4: 123
Right 1090780400 11:130002253-130002275 CGTCCCGGCCCAACCAACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 37
1090780391_1090780404 11 Left 1090780391 11:130002224-130002246 CCGCCGGAGCGCGCAGGCCGCCC 0: 1
1: 0
2: 1
3: 16
4: 123
Right 1090780404 11:130002258-130002280 CGGCCCAACCAACGCGGGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 16
1090780391_1090780408 15 Left 1090780391 11:130002224-130002246 CCGCCGGAGCGCGCAGGCCGCCC 0: 1
1: 0
2: 1
3: 16
4: 123
Right 1090780408 11:130002262-130002284 CCAACCAACGCGGGCAGGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 83
1090780391_1090780403 10 Left 1090780391 11:130002224-130002246 CCGCCGGAGCGCGCAGGCCGCCC 0: 1
1: 0
2: 1
3: 16
4: 123
Right 1090780403 11:130002257-130002279 CCGGCCCAACCAACGCGGGCAGG 0: 1
1: 0
2: 0
3: 1
4: 39
1090780391_1090780410 20 Left 1090780391 11:130002224-130002246 CCGCCGGAGCGCGCAGGCCGCCC 0: 1
1: 0
2: 1
3: 16
4: 123
Right 1090780410 11:130002267-130002289 CAACGCGGGCAGGGGAGGAGAGG 0: 1
1: 0
2: 1
3: 22
4: 328
1090780391_1090780405 12 Left 1090780391 11:130002224-130002246 CCGCCGGAGCGCGCAGGCCGCCC 0: 1
1: 0
2: 1
3: 16
4: 123
Right 1090780405 11:130002259-130002281 GGCCCAACCAACGCGGGCAGGGG 0: 1
1: 0
2: 0
3: 1
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090780391 Original CRISPR GGGCGGCCTGCGCGCTCCGG CGG (reversed) Intronic