ID: 1090780393

View in Genome Browser
Species Human (GRCh38)
Location 11:130002238-130002260
Sequence AGGCCGCCCAACCGCCGTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 55}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090780382_1090780393 20 Left 1090780382 11:130002195-130002217 CCGCGCCCGGAGCGCCCGCGCAA 0: 1
1: 0
2: 1
3: 7
4: 73
Right 1090780393 11:130002238-130002260 AGGCCGCCCAACCGCCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 55
1090780384_1090780393 14 Left 1090780384 11:130002201-130002223 CCGGAGCGCCCGCGCAACCGCCG 0: 1
1: 0
2: 0
3: 11
4: 101
Right 1090780393 11:130002238-130002260 AGGCCGCCCAACCGCCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 55
1090780379_1090780393 28 Left 1090780379 11:130002187-130002209 CCTGCCCGCCGCGCCCGGAGCGC 0: 1
1: 0
2: 5
3: 74
4: 474
Right 1090780393 11:130002238-130002260 AGGCCGCCCAACCGCCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 55
1090780383_1090780393 15 Left 1090780383 11:130002200-130002222 CCCGGAGCGCCCGCGCAACCGCC 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1090780393 11:130002238-130002260 AGGCCGCCCAACCGCCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 55
1090780380_1090780393 24 Left 1090780380 11:130002191-130002213 CCCGCCGCGCCCGGAGCGCCCGC 0: 1
1: 3
2: 12
3: 55
4: 468
Right 1090780393 11:130002238-130002260 AGGCCGCCCAACCGCCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 55
1090780388_1090780393 -3 Left 1090780388 11:130002218-130002240 CCGCCGCCGCCGGAGCGCGCAGG 0: 1
1: 0
2: 2
3: 27
4: 235
Right 1090780393 11:130002238-130002260 AGGCCGCCCAACCGCCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 55
1090780381_1090780393 23 Left 1090780381 11:130002192-130002214 CCGCCGCGCCCGGAGCGCCCGCG 0: 1
1: 1
2: 4
3: 53
4: 382
Right 1090780393 11:130002238-130002260 AGGCCGCCCAACCGCCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 55
1090780390_1090780393 -6 Left 1090780390 11:130002221-130002243 CCGCCGCCGGAGCGCGCAGGCCG 0: 1
1: 0
2: 4
3: 18
4: 158
Right 1090780393 11:130002238-130002260 AGGCCGCCCAACCGCCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 55
1090780391_1090780393 -9 Left 1090780391 11:130002224-130002246 CCGCCGGAGCGCGCAGGCCGCCC 0: 1
1: 0
2: 1
3: 16
4: 123
Right 1090780393 11:130002238-130002260 AGGCCGCCCAACCGCCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 55
1090780386_1090780393 6 Left 1090780386 11:130002209-130002231 CCCGCGCAACCGCCGCCGCCGGA 0: 1
1: 0
2: 2
3: 66
4: 474
Right 1090780393 11:130002238-130002260 AGGCCGCCCAACCGCCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 55
1090780387_1090780393 5 Left 1090780387 11:130002210-130002232 CCGCGCAACCGCCGCCGCCGGAG 0: 1
1: 0
2: 1
3: 33
4: 457
Right 1090780393 11:130002238-130002260 AGGCCGCCCAACCGCCGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090780393 Original CRISPR AGGCCGCCCAACCGCCGTCC CGG Intronic