ID: 1090780400

View in Genome Browser
Species Human (GRCh38)
Location 11:130002253-130002275
Sequence CGTCCCGGCCCAACCAACGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 37}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090780384_1090780400 29 Left 1090780384 11:130002201-130002223 CCGGAGCGCCCGCGCAACCGCCG 0: 1
1: 0
2: 0
3: 11
4: 101
Right 1090780400 11:130002253-130002275 CGTCCCGGCCCAACCAACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 37
1090780388_1090780400 12 Left 1090780388 11:130002218-130002240 CCGCCGCCGCCGGAGCGCGCAGG 0: 1
1: 0
2: 2
3: 27
4: 235
Right 1090780400 11:130002253-130002275 CGTCCCGGCCCAACCAACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 37
1090780386_1090780400 21 Left 1090780386 11:130002209-130002231 CCCGCGCAACCGCCGCCGCCGGA 0: 1
1: 0
2: 2
3: 66
4: 474
Right 1090780400 11:130002253-130002275 CGTCCCGGCCCAACCAACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 37
1090780392_1090780400 3 Left 1090780392 11:130002227-130002249 CCGGAGCGCGCAGGCCGCCCAAC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1090780400 11:130002253-130002275 CGTCCCGGCCCAACCAACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 37
1090780383_1090780400 30 Left 1090780383 11:130002200-130002222 CCCGGAGCGCCCGCGCAACCGCC 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1090780400 11:130002253-130002275 CGTCCCGGCCCAACCAACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 37
1090780387_1090780400 20 Left 1090780387 11:130002210-130002232 CCGCGCAACCGCCGCCGCCGGAG 0: 1
1: 0
2: 1
3: 33
4: 457
Right 1090780400 11:130002253-130002275 CGTCCCGGCCCAACCAACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 37
1090780391_1090780400 6 Left 1090780391 11:130002224-130002246 CCGCCGGAGCGCGCAGGCCGCCC 0: 1
1: 0
2: 1
3: 16
4: 123
Right 1090780400 11:130002253-130002275 CGTCCCGGCCCAACCAACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 37
1090780390_1090780400 9 Left 1090780390 11:130002221-130002243 CCGCCGCCGGAGCGCGCAGGCCG 0: 1
1: 0
2: 4
3: 18
4: 158
Right 1090780400 11:130002253-130002275 CGTCCCGGCCCAACCAACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090780400 Original CRISPR CGTCCCGGCCCAACCAACGC GGG Intronic