ID: 1090780404

View in Genome Browser
Species Human (GRCh38)
Location 11:130002258-130002280
Sequence CGGCCCAACCAACGCGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 18
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 16}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090780386_1090780404 26 Left 1090780386 11:130002209-130002231 CCCGCGCAACCGCCGCCGCCGGA 0: 1
1: 0
2: 2
3: 66
4: 474
Right 1090780404 11:130002258-130002280 CGGCCCAACCAACGCGGGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 16
1090780395_1090780404 -9 Left 1090780395 11:130002244-130002266 CCCAACCGCCGTCCCGGCCCAAC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1090780404 11:130002258-130002280 CGGCCCAACCAACGCGGGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 16
1090780394_1090780404 -6 Left 1090780394 11:130002241-130002263 CCGCCCAACCGCCGTCCCGGCCC 0: 1
1: 0
2: 2
3: 42
4: 625
Right 1090780404 11:130002258-130002280 CGGCCCAACCAACGCGGGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 16
1090780387_1090780404 25 Left 1090780387 11:130002210-130002232 CCGCGCAACCGCCGCCGCCGGAG 0: 1
1: 0
2: 1
3: 33
4: 457
Right 1090780404 11:130002258-130002280 CGGCCCAACCAACGCGGGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 16
1090780396_1090780404 -10 Left 1090780396 11:130002245-130002267 CCAACCGCCGTCCCGGCCCAACC 0: 1
1: 0
2: 1
3: 11
4: 195
Right 1090780404 11:130002258-130002280 CGGCCCAACCAACGCGGGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 16
1090780388_1090780404 17 Left 1090780388 11:130002218-130002240 CCGCCGCCGCCGGAGCGCGCAGG 0: 1
1: 0
2: 2
3: 27
4: 235
Right 1090780404 11:130002258-130002280 CGGCCCAACCAACGCGGGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 16
1090780391_1090780404 11 Left 1090780391 11:130002224-130002246 CCGCCGGAGCGCGCAGGCCGCCC 0: 1
1: 0
2: 1
3: 16
4: 123
Right 1090780404 11:130002258-130002280 CGGCCCAACCAACGCGGGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 16
1090780390_1090780404 14 Left 1090780390 11:130002221-130002243 CCGCCGCCGGAGCGCGCAGGCCG 0: 1
1: 0
2: 4
3: 18
4: 158
Right 1090780404 11:130002258-130002280 CGGCCCAACCAACGCGGGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 16
1090780392_1090780404 8 Left 1090780392 11:130002227-130002249 CCGGAGCGCGCAGGCCGCCCAAC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1090780404 11:130002258-130002280 CGGCCCAACCAACGCGGGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090780404 Original CRISPR CGGCCCAACCAACGCGGGCA GGG Intronic