ID: 1090780410

View in Genome Browser
Species Human (GRCh38)
Location 11:130002267-130002289
Sequence CAACGCGGGCAGGGGAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 328}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090780398_1090780410 -8 Left 1090780398 11:130002252-130002274 CCGTCCCGGCCCAACCAACGCGG 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1090780410 11:130002267-130002289 CAACGCGGGCAGGGGAGGAGAGG 0: 1
1: 0
2: 1
3: 22
4: 328
1090780391_1090780410 20 Left 1090780391 11:130002224-130002246 CCGCCGGAGCGCGCAGGCCGCCC 0: 1
1: 0
2: 1
3: 16
4: 123
Right 1090780410 11:130002267-130002289 CAACGCGGGCAGGGGAGGAGAGG 0: 1
1: 0
2: 1
3: 22
4: 328
1090780395_1090780410 0 Left 1090780395 11:130002244-130002266 CCCAACCGCCGTCCCGGCCCAAC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1090780410 11:130002267-130002289 CAACGCGGGCAGGGGAGGAGAGG 0: 1
1: 0
2: 1
3: 22
4: 328
1090780388_1090780410 26 Left 1090780388 11:130002218-130002240 CCGCCGCCGCCGGAGCGCGCAGG 0: 1
1: 0
2: 2
3: 27
4: 235
Right 1090780410 11:130002267-130002289 CAACGCGGGCAGGGGAGGAGAGG 0: 1
1: 0
2: 1
3: 22
4: 328
1090780394_1090780410 3 Left 1090780394 11:130002241-130002263 CCGCCCAACCGCCGTCCCGGCCC 0: 1
1: 0
2: 2
3: 42
4: 625
Right 1090780410 11:130002267-130002289 CAACGCGGGCAGGGGAGGAGAGG 0: 1
1: 0
2: 1
3: 22
4: 328
1090780390_1090780410 23 Left 1090780390 11:130002221-130002243 CCGCCGCCGGAGCGCGCAGGCCG 0: 1
1: 0
2: 4
3: 18
4: 158
Right 1090780410 11:130002267-130002289 CAACGCGGGCAGGGGAGGAGAGG 0: 1
1: 0
2: 1
3: 22
4: 328
1090780392_1090780410 17 Left 1090780392 11:130002227-130002249 CCGGAGCGCGCAGGCCGCCCAAC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1090780410 11:130002267-130002289 CAACGCGGGCAGGGGAGGAGAGG 0: 1
1: 0
2: 1
3: 22
4: 328
1090780396_1090780410 -1 Left 1090780396 11:130002245-130002267 CCAACCGCCGTCCCGGCCCAACC 0: 1
1: 0
2: 1
3: 11
4: 195
Right 1090780410 11:130002267-130002289 CAACGCGGGCAGGGGAGGAGAGG 0: 1
1: 0
2: 1
3: 22
4: 328
1090780397_1090780410 -5 Left 1090780397 11:130002249-130002271 CCGCCGTCCCGGCCCAACCAACG 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1090780410 11:130002267-130002289 CAACGCGGGCAGGGGAGGAGAGG 0: 1
1: 0
2: 1
3: 22
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090780410 Original CRISPR CAACGCGGGCAGGGGAGGAG AGG Intronic