ID: 1090782108

View in Genome Browser
Species Human (GRCh38)
Location 11:130016417-130016439
Sequence ATTGCCTGGGGAGTGAAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090782101_1090782108 23 Left 1090782101 11:130016371-130016393 CCTAGAAAATGCAGACTAATCTG No data
Right 1090782108 11:130016417-130016439 ATTGCCTGGGGAGTGAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090782108 Original CRISPR ATTGCCTGGGGAGTGAAGAG AGG Intergenic
No off target data available for this crispr