ID: 1090782718

View in Genome Browser
Species Human (GRCh38)
Location 11:130021778-130021800
Sequence CTCACTGCCCAGGGCTGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090782718_1090782728 -3 Left 1090782718 11:130021778-130021800 CCCTACCAGCCCTGGGCAGTGAG No data
Right 1090782728 11:130021798-130021820 GAGGGGCTTAGCGCCCGGGCCGG No data
1090782718_1090782727 -7 Left 1090782718 11:130021778-130021800 CCCTACCAGCCCTGGGCAGTGAG No data
Right 1090782727 11:130021794-130021816 CAGTGAGGGGCTTAGCGCCCGGG No data
1090782718_1090782726 -8 Left 1090782718 11:130021778-130021800 CCCTACCAGCCCTGGGCAGTGAG No data
Right 1090782726 11:130021793-130021815 GCAGTGAGGGGCTTAGCGCCCGG No data
1090782718_1090782732 24 Left 1090782718 11:130021778-130021800 CCCTACCAGCCCTGGGCAGTGAG No data
Right 1090782732 11:130021825-130021847 TGCTGTGCTCAATTTCTCGCCGG 0: 80
1: 134
2: 213
3: 395
4: 421
1090782718_1090782733 25 Left 1090782718 11:130021778-130021800 CCCTACCAGCCCTGGGCAGTGAG No data
Right 1090782733 11:130021826-130021848 GCTGTGCTCAATTTCTCGCCGGG 0: 75
1: 208
2: 453
3: 477
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090782718 Original CRISPR CTCACTGCCCAGGGCTGGTA GGG (reversed) Intergenic
No off target data available for this crispr