ID: 1090786025

View in Genome Browser
Species Human (GRCh38)
Location 11:130048393-130048415
Sequence GAACCCAAAGTAAAAGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090786025_1090786027 -8 Left 1090786025 11:130048393-130048415 CCTCCTTCTTTTACTTTGGGTTC No data
Right 1090786027 11:130048408-130048430 TTGGGTTCAAGCTCAAGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090786025 Original CRISPR GAACCCAAAGTAAAAGAAGG AGG (reversed) Intergenic