ID: 1090791338

View in Genome Browser
Species Human (GRCh38)
Location 11:130092683-130092705
Sequence CATGAGAGGGAGACCGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1642
Summary {0: 2, 1: 3, 2: 97, 3: 184, 4: 1356}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090791330_1090791338 -8 Left 1090791330 11:130092668-130092690 CCAGCTTCAGCTCCGCATGAGAG 0: 3
1: 135
2: 183
3: 613
4: 576
Right 1090791338 11:130092683-130092705 CATGAGAGGGAGACCGTGGGGGG 0: 2
1: 3
2: 97
3: 184
4: 1356
1090791329_1090791338 13 Left 1090791329 11:130092647-130092669 CCGAGATGGCAGCAGTACAGTCC 0: 791
1: 492
2: 154
3: 345
4: 7246
Right 1090791338 11:130092683-130092705 CATGAGAGGGAGACCGTGGGGGG 0: 2
1: 3
2: 97
3: 184
4: 1356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090791338 Original CRISPR CATGAGAGGGAGACCGTGGG GGG Intronic
900139774 1:1134820-1134842 CAGGAGGGGGACACCGTGAGGGG + Intergenic
900303548 1:1990369-1990391 CGGGAGAGGGAGACAGTGGCGGG + Intronic
900544514 1:3220992-3221014 CAAGAGAGGGAGACCCTGTCTGG + Intronic
900605998 1:3523808-3523830 CAGGGGAGTGAGCCCGTGGGTGG - Intronic
900728907 1:4238619-4238641 CATGAGAGGGACCCAGTAGGAGG - Intergenic
900735461 1:4296980-4297002 CATGGGAGGGACCCAGTGGGAGG - Intergenic
900858445 1:5205305-5205327 CATGAGAGGGACCCAGTGGGAGG - Intergenic
900869604 1:5292705-5292727 CATGGGAGGGACCCAGTGGGAGG - Intergenic
900877987 1:5359423-5359445 CATGGGAGGGACCCAGTGGGAGG + Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901784092 1:11613113-11613135 CATGGGAGGGACCCCATGGGAGG + Intergenic
902125830 1:14210143-14210165 CATGAGAGGGACACAGTGGGAGG + Intergenic
902134756 1:14295380-14295402 CATGAGAGGGAGAAGCTGGGAGG - Intergenic
902247864 1:15133441-15133463 CATGGGAGGGACCCAGTGGGAGG + Intergenic
902688508 1:18095005-18095027 CATGAGAGGGACCCAGTGGGAGG - Intergenic
902931741 1:19736330-19736352 CATGGGAGGGACCCGGTGGGAGG - Intronic
902970961 1:20049515-20049537 CATGGGAAGGACACAGTGGGAGG + Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903163152 1:21503477-21503499 AGGGAGAGGGAGACCGTGGGGGG + Intergenic
903299157 1:22365709-22365731 CATGGGAGGGACCCCCTGGGAGG + Intergenic
903562802 1:24241282-24241304 CATTGGAGGGAGCCGGTGGGGGG - Intergenic
903687967 1:25146458-25146480 CAAGGGAGGGAGAGAGTGGGAGG - Intergenic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904469549 1:30727959-30727981 GAAGAGAGGGAGATGGTGGGAGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904996794 1:34637695-34637717 CATGGGAGGGACCCAGTGGGGGG - Intergenic
905493383 1:38362881-38362903 CATGAGAGGGACCCAGTGGAAGG - Intergenic
905655364 1:39683298-39683320 CATGAGAGGGAGAGAGTGATAGG - Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906549828 1:46655169-46655191 CATGGGAGGGACACAATGGGAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
906848298 1:49218779-49218801 CATGGGAGGGACACAGCGGGAGG + Intronic
907556214 1:55346254-55346276 CATGGGAGGGACCCAGTGGGTGG - Intergenic
907778744 1:57544669-57544691 CATGGGAGGGACCCAGTGGGGGG + Intronic
907846069 1:58208134-58208156 CATGAGAGGGACCCAGTGGGAGG - Intronic
908048856 1:60205707-60205729 CATGGGAGGGACCCAGTGGGAGG + Intergenic
908068756 1:60435372-60435394 CATGGGAGGGACCCAGTGGGAGG - Intergenic
908085881 1:60633306-60633328 CATGGGAGGGACCCAGTGGGAGG - Intergenic
908211720 1:61906953-61906975 CATGGGAGGGACCCAGTGGGAGG + Intronic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445441 1:64195556-64195578 CATGAGAGGGATTCCGTGTAAGG - Intergenic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908487522 1:64610144-64610166 CATGGGAGGGACCCAGTGGGAGG - Intronic
908613955 1:65896389-65896411 CATGGGAGGGACACAGTGGGAGG - Intronic
908699437 1:66881870-66881892 CATGAGAGGAACCCAGTGGGAGG + Intronic
908800077 1:67871079-67871101 CATGAGAGGGACCCAGTGGGAGG + Intergenic
909235804 1:73151902-73151924 CATGGGAGGGACCCAGTGGGAGG - Intergenic
909241009 1:73213114-73213136 CATGGGAGGGACCCAGTGGGAGG - Intergenic
909376896 1:74951188-74951210 CATGGGAGGGACCCAGTGGGAGG + Intergenic
909424750 1:75510123-75510145 CATGGGAGGGACCCAGTGGGAGG - Intronic
909432665 1:75607620-75607642 CATGGGAGGGACCCAGTGGGAGG + Intronic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
909795904 1:79735575-79735597 CAAGAGAGGGACTCAGTGGGAGG - Intergenic
909810408 1:79925726-79925748 CATGAGAGGGACTCAGTGGCAGG + Intergenic
909871076 1:80739821-80739843 CATGAGAGGGACCCAGTGGGAGG - Intergenic
910114238 1:83714791-83714813 CATGGGAGGGACCCAGTGGGAGG - Intergenic
910378875 1:86603803-86603825 CATGAGAGGGACCCAGTGGGAGG - Intergenic
910417313 1:87014423-87014445 CATGGGAGGGAACCAGTGGGAGG - Intronic
910456730 1:87405653-87405675 CATGGGAGGGACCCAGTGGGAGG + Intergenic
910940553 1:92528779-92528801 GATGAGAGAGAGAGTGTGGGAGG + Intronic
911011646 1:93287391-93287413 CATGGGAGGGACCCGGTGGGAGG + Intergenic
911511362 1:98810523-98810545 CATGGGAGGGACCCAGTGGGAGG - Intergenic
911546556 1:99224659-99224681 TATGAGAGGGAGCCCATGAGTGG + Intergenic
911780477 1:101869703-101869725 CATGGGAGGGACCCAGTGGGAGG + Intronic
911801736 1:102147976-102147998 CATGGGAGGGACCCAGTGGGAGG + Intergenic
911858404 1:102912710-102912732 CCTGAGAGGGACCCAGTGGGAGG + Intronic
911969674 1:104415945-104415967 CATGGGAGGGATCCAGTGGGAGG - Intergenic
911990403 1:104689163-104689185 CATGAGAGGGACCTGGTGGGAGG - Intergenic
912068773 1:105780447-105780469 CATGGGAGGGACCCAGTGGGTGG + Intergenic
912205903 1:107509560-107509582 CATGGGAGGGACCCGGTGGGAGG + Intergenic
912607157 1:111002995-111003017 CATGGGAGGGATGCAGTGGGAGG + Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913161462 1:116149738-116149760 CATGAGGGAGAGAGCATGGGAGG - Intergenic
913396993 1:118382341-118382363 CATGGGAGGGACCCAGTGGGAGG + Intergenic
913668258 1:121070506-121070528 AATGAGAGGGACCCAGTGGGAGG - Intergenic
913668508 1:121072327-121072349 CATGGGAGGGACCCAGTGGGAGG - Intergenic
913710140 1:121474466-121474488 CATGGGAGGGACCCAGTGGGAGG - Intergenic
913998199 1:143668711-143668733 CATGAAAGTGAGACCTTGTGAGG - Intergenic
914020002 1:143857947-143857969 AATGAGAGGGACCCAGTGGGAGG - Intergenic
914020252 1:143859770-143859792 CATGGGAGGGACCCAGTGGGAGG - Intergenic
914658500 1:149765861-149765883 AATGAGAGGGACCCAGTGGGAGG - Intergenic
914658752 1:149767682-149767704 CATGGGAGGGACCCAGTGGGAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915665576 1:157441230-157441252 CATGAGAGGGACCCATTGGGAGG - Intergenic
915786892 1:158623487-158623509 CATGGGAGGGAGCCAGTGGGAGG + Intronic
916320666 1:163499733-163499755 CAAGAGAGGGAGACCGTAGAAGG + Intergenic
916767925 1:167879884-167879906 CATGAGAGGGGAGCAGTGGGAGG - Intronic
916828289 1:168464479-168464501 CATGAGAGGGACCTGGTGGGAGG - Intergenic
916949015 1:169759902-169759924 CATGGGAGGGACCCTGTGGGAGG - Intronic
917088782 1:171330682-171330704 CATGGGAGGGACCCAGTGGGAGG - Intronic
917154046 1:171976539-171976561 CATGGGAGGGACCCAGTGGGAGG - Intronic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917376264 1:174351052-174351074 CATGAGAGGGAGACCGTGGGGGG + Intronic
917437675 1:175037651-175037673 CATGAGAGTGACCCGGTGGGAGG - Intergenic
917638383 1:176958833-176958855 CATGGGATGGGGACGGTGGGAGG - Intronic
917652911 1:177096568-177096590 TATGAGAGGGATCCAGTGGGAGG + Intronic
917708149 1:177655829-177655851 CAGGATATGGAGTCCGTGGGTGG + Intergenic
917848860 1:179043150-179043172 CATGGGAGGGAGGCCAAGGGAGG - Intronic
918162714 1:181916069-181916091 CATGGGAGGGACCCAGTGGGAGG + Intergenic
918670578 1:187210539-187210561 CATGGGAGGGACCCGGTGGGAGG + Intergenic
918735521 1:188057716-188057738 CATGGGAGGGACCCAGTGGGAGG - Intergenic
918808789 1:189087585-189087607 CATGAGAGGGACCTTGTGGGAGG + Intergenic
918864848 1:189882055-189882077 CATGGGAGGGACTCAGTGGGAGG + Intergenic
918886357 1:190199197-190199219 CATGGGAGGGACCCAGTGGGAGG - Intronic
918969525 1:191396662-191396684 CATGAGAGGAACTCGGTGGGAGG + Intergenic
919277617 1:195440862-195440884 CATAAGAGGGACCCAGTGGGAGG - Intergenic
919398464 1:197080387-197080409 CATGGGAGGGACCCAGTGGGAGG + Intergenic
919545738 1:198915938-198915960 CATGAGAGTTAGACAGTGAGAGG - Intergenic
919640344 1:200039694-200039716 CATGACAAGGCGACCGCGGGCGG - Exonic
919732549 1:200922524-200922546 CATGAGAGAGAGACTGCCGGGGG + Intergenic
920230470 1:204466641-204466663 AAAGAGAGAGAGACAGTGGGGGG + Intronic
921272285 1:213483267-213483289 CATGGGAGGGACCCAGTGGGTGG - Intergenic
921429048 1:215042098-215042120 CATGGGAGGGAACCCGTGGGAGG - Intronic
921684119 1:218070463-218070485 CATGGAAGGGACCCCGTGGGAGG + Intergenic
921706023 1:218323710-218323732 CATGAGAGGGAGGCCGAGGTGGG - Intronic
921799085 1:219381112-219381134 CATGAGAGGGACCGGGTGGGAGG + Intergenic
922069971 1:222182556-222182578 CATGGGAGGGAAATGGTGGGAGG + Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922625578 1:227038097-227038119 CATGGGAGGGACACAGTGGGAGG + Intronic
922740329 1:228010770-228010792 GATGTGAGGGAGACCCTGGAGGG - Intronic
923088063 1:230716521-230716543 CATGGGAGGGACCCAGTGGGAGG + Intergenic
923249135 1:232163223-232163245 CATGGGAGGGACCCGGTGGGAGG - Intergenic
923427687 1:233888456-233888478 CATGAGAGGGACCAGGTGGGAGG + Intergenic
923622206 1:235588273-235588295 CCTGAGAGGGAGGCCATGGAGGG - Intronic
923773040 1:236954163-236954185 GATGGGAGGGAGGCCCTGGGTGG + Intergenic
923788361 1:237090157-237090179 CATGGGAGGGATCCAGTGGGAGG - Intronic
923808853 1:237289625-237289647 CATGGGAGGGACCCAGTGGGAGG - Intronic
923904605 1:238369906-238369928 CATGAGAGGGACCCAGTGGAAGG - Intergenic
923917559 1:238526301-238526323 CATGGGAGGAACCCCGTGGGAGG + Intergenic
924036202 1:239940996-239941018 CATGGGAGGGACCCAGTGGGAGG + Intergenic
924242574 1:242055258-242055280 CATGGGAGGGACCCAGTGGGAGG - Intergenic
924315399 1:242790232-242790254 CATGGGAGGGACCCAGTGGGAGG - Intergenic
924430294 1:243990699-243990721 CATGGGAGGGACACAGTGGGAGG - Intergenic
924943591 1:248829775-248829797 CATCAGAGGGAGACCGTGCAGGG - Intergenic
1063068982 10:2640173-2640195 CGTGAGAAGGAGCCAGTGGGAGG + Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063211155 10:3882505-3882527 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1063298617 10:4831594-4831616 CATGGGAGGGACCCAGTGGGAGG - Intronic
1063462882 10:6225581-6225603 CATGAGAGGGACAGCGTGATGGG - Intronic
1063471887 10:6294538-6294560 CATGGGAGGGACCCGGTGGGAGG - Intergenic
1063927845 10:10997922-10997944 CATGGGAGGGACCCGGTGGGAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064170516 10:13028145-13028167 CATGAGAGGGACCCAGTGGGAGG + Intronic
1064281356 10:13954484-13954506 CATGAGAGAGACCCGGTGGGAGG - Intronic
1064498320 10:15939702-15939724 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1064794085 10:18991588-18991610 CATGAGAGAGACCCGGTGGGAGG - Intergenic
1064823199 10:19362988-19363010 GAAGTGAGGGAGACTGTGGGAGG + Intronic
1064941572 10:20741325-20741347 CATGAGAGGGACCTAGTGGGAGG + Intergenic
1065120069 10:22520707-22520729 CATGAGAGAGAGAGGGAGGGAGG - Intergenic
1065324980 10:24542861-24542883 CCTGAGAGGGAGAACGGAGGAGG - Exonic
1065386638 10:25140262-25140284 CATGGGAGGGACCCGGTGGGAGG + Intergenic
1065456200 10:25909145-25909167 CATGGGAGGGACCCCGTGGGAGG + Intergenic
1065778588 10:29145368-29145390 CGTGGGAGGGACCCCGTGGGAGG + Intergenic
1066113919 10:32222902-32222924 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1066154091 10:32656623-32656645 CATGGGAGGGACCCAGTGGGAGG - Intronic
1066260380 10:33724100-33724122 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1066277313 10:33881602-33881624 CATGAGAGGGACCTGGTGGGAGG - Intergenic
1066679161 10:37919866-37919888 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1067460063 10:46451611-46451633 CATGAGAGAGAGACAGAGAGAGG - Intergenic
1067627127 10:47933002-47933024 CATGAGAGAGAGACAGAGAGAGG + Intergenic
1068066011 10:52131873-52131895 AATGTGAGGGAGACACTGGGAGG + Intronic
1068198700 10:53753420-53753442 CATGGGAGGGACACAGTGGGAGG - Intergenic
1068252203 10:54456756-54456778 CATGGGAGGGACACAGTGGGAGG + Intronic
1068331657 10:55578906-55578928 TATGGGAGGGAACCCGTGGGAGG - Intronic
1068352643 10:55869081-55869103 CATGAGAGGCCGGGCGTGGGGGG - Intergenic
1068909002 10:62358428-62358450 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1068924929 10:62526537-62526559 CATGGGAGGGACACAGTGGGAGG - Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069198692 10:65586657-65586679 CATGAGAGGGACTCAGTGAGAGG + Intergenic
1069224494 10:65924987-65925009 CATGGGAGGGACCCAGTGGGAGG - Intronic
1069339724 10:67396760-67396782 CATGGGAGGGACACGGTGGGAGG + Intronic
1069606692 10:69743373-69743395 CAGCAGAGGGCGACAGTGGGAGG + Intergenic
1069741622 10:70688829-70688851 CATGAGAGGGAGACCGGAGGGGG + Intronic
1069834386 10:71299485-71299507 CAAGAGAGAGAGAGCGGGGGTGG - Exonic
1070389573 10:75957731-75957753 CATGAGCGGGAGAGAGTGAGAGG + Intronic
1070404903 10:76085967-76085989 CATGAGAAGGAGGAGGTGGGAGG - Intronic
1071159152 10:82726378-82726400 CATGGGAGGGACCCAGTGGGAGG + Intronic
1071159421 10:82728331-82728353 CATGGGAGGGAGCCAATGGGAGG + Intronic
1071222061 10:83479046-83479068 CAGGAGAGGGAGACAGATGGAGG - Intergenic
1071266339 10:83968133-83968155 CATGGGAGGGAGTCAGTGGGAGG - Intergenic
1071280246 10:84095018-84095040 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1071756394 10:88545575-88545597 CATGGGAGGGACCCAGTGGGAGG - Intronic
1072013623 10:91324260-91324282 AAAGAGAGGGAGACCGAGAGGGG + Intergenic
1072050017 10:91694006-91694028 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1072492998 10:95927351-95927373 CCTGAGAGTGAGATGGTGGGAGG - Intronic
1072528732 10:96298186-96298208 CATGAGAGGGAGCCTGTCGGGGG - Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072634318 10:97167724-97167746 CATGGGAGGGAGCCGGTGGGAGG + Intronic
1072690924 10:97571975-97571997 CCTGACAGGGAAACCCTGGGAGG + Intergenic
1073708566 10:106014660-106014682 CATGAGAGGGACCTGGTGGGAGG - Intergenic
1073880162 10:107972249-107972271 TATGGGAGGGAGCCAGTGGGAGG + Intergenic
1073946135 10:108752804-108752826 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1073965017 10:108978746-108978768 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1073981874 10:109163393-109163415 CATGGGAGGGACCCCATGGGGGG - Intergenic
1073990827 10:109260907-109260929 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1074902301 10:117829158-117829180 ACTGAGAGGGAGACAGTGAGAGG - Intergenic
1075013347 10:118893216-118893238 CATGGAAGGGATCCCGTGGGAGG - Intergenic
1075199464 10:120390129-120390151 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1075378819 10:122001459-122001481 CATGGGAGGGACCCAGTGGGAGG - Intronic
1075505622 10:123018877-123018899 CATGGGAGGGACCCAGTGGGAGG - Intronic
1075581729 10:123623884-123623906 CATGAGAGGGTAAGGGTGGGGGG + Intergenic
1075593918 10:123713638-123713660 CATGGGAGGGACCCAGTGGGAGG - Intronic
1075941854 10:126396561-126396583 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1076125042 10:127967351-127967373 CATGGGAGGGACCCTGTGGGAGG + Intronic
1076261771 10:129072112-129072134 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1076528752 10:131130298-131130320 CATGAGAGGGACCCAGTGGGAGG - Intronic
1076576034 10:131468848-131468870 CATGGGAGGGACCCGGTGGGAGG - Intergenic
1077201815 11:1311392-1311414 CATGAAAGGAAAACGGTGGGGGG - Intergenic
1077514491 11:2993133-2993155 CATGAGAGGGAGAACAGGGCGGG - Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078301328 11:10134266-10134288 CATGGGAGGGACCCAGTGGGAGG - Intronic
1078515093 11:12015049-12015071 CATGGGAGGGATCCAGTGGGAGG + Intergenic
1078684719 11:13518277-13518299 CATGGGAGGGAACCAGTGGGAGG + Intergenic
1078857378 11:15217317-15217339 CATGAGAGGGACCTGGTGGGAGG - Intronic
1079538735 11:21546479-21546501 CATGGGAGGGAACCAGTGGGAGG + Intronic
1079750685 11:24192325-24192347 CATGAGAGGGACTCCGTGGGAGG - Intergenic
1079920488 11:26427972-26427994 CATGGGAGGGACCCAGTGGGAGG - Intronic
1080019039 11:27539892-27539914 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1080104189 11:28494639-28494661 CATGGGAGGGACTCAGTGGGAGG + Intergenic
1080115258 11:28614987-28615009 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1080238483 11:30099314-30099336 CATGAGAGGAAGCTGGTGGGAGG - Intergenic
1080425244 11:32148804-32148826 CATGGGAGGGATCCAGTGGGAGG - Intergenic
1080477648 11:32610235-32610257 CATGGGAGGGACCCAGTGGGAGG - Intronic
1080745896 11:35108452-35108474 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1080976307 11:37344875-37344897 CATGGGAGGGACCCGGTGGGAGG + Intergenic
1081076058 11:38675337-38675359 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1081166971 11:39819355-39819377 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1081210738 11:40330757-40330779 CATGGGAGGGACCCAGTGGGAGG - Intronic
1081250880 11:40831850-40831872 CATGGGAGGGACCCAGTGGGAGG - Intronic
1081278722 11:41183078-41183100 CATGGGAGGGACCCAGTGGGAGG - Intronic
1081291179 11:41327684-41327706 CATGGGAGGGACCCCGTGGGAGG + Intronic
1081332248 11:41818446-41818468 CATGTGAGGGACTCAGTGGGAGG + Intergenic
1081349238 11:42028118-42028140 CATGGGAGGGACGCAGTGGGAGG - Intergenic
1081737402 11:45413701-45413723 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1081746010 11:45473095-45473117 CCACAGAGGGAGACCGTTGGTGG - Intergenic
1082229553 11:49746295-49746317 CATGGGAAGGAGCCAGTGGGAGG - Intergenic
1082570967 11:54739728-54739750 CATGAGAGGGACGAGGTGGGAGG + Intergenic
1082667860 11:55996609-55996631 CATAGGAGGGACACCATGGGAGG + Intergenic
1082686407 11:56243834-56243856 CATGGGAGGGACATGGTGGGAGG + Intergenic
1082687748 11:56260614-56260636 CATGGGAGGGAGGCTGTGGGGGG - Intergenic
1082706037 11:56496522-56496544 AGGGAGAGGGAGACCGTGGAAGG - Intergenic
1082734418 11:56839954-56839976 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1082748594 11:56994997-56995019 CATGAGAGGAACCCGGTGGGAGG - Intergenic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083162994 11:60867221-60867243 GGTGAGAGGGAGACAGTGGAGGG + Intergenic
1083251088 11:61467718-61467740 CATGGGAGGGACCCAGTGGGAGG + Intronic
1083496348 11:63057725-63057747 CATGGGAGGGACTCAGTGGGAGG - Intergenic
1083506143 11:63159343-63159365 CATGGGAGGGAGCCTGTGGGAGG + Intronic
1083506418 11:63161492-63161514 CATGGGAGGGATCCAGTGGGAGG + Intronic
1083519230 11:63292319-63292341 CATGGGAGGGAGCCAGTGGGAGG - Intronic
1083530120 11:63413132-63413154 CATGGGAGGGACCCGGTGGGAGG - Intergenic
1084066298 11:66706207-66706229 CATGACAGCGAGACCGTTAGAGG - Intronic
1085377290 11:76076506-76076528 CATGGGAGGGACCCAGTGGGAGG - Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085496827 11:76978041-76978063 CATGGGAGGGAGGCCGAGGCGGG + Intronic
1085732238 11:79009884-79009906 CATGGGAGGGACCCTGTGGGAGG + Intronic
1085799913 11:79579907-79579929 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1085857410 11:80190914-80190936 CATGAGAGGGACCTGGTGGGAGG + Intergenic
1085906421 11:80769622-80769644 CATGGGAGGGACACTGTGGGAGG + Intergenic
1086111788 11:83207237-83207259 CATGGGAGGGACACAGTGGGAGG - Intronic
1086606630 11:88703593-88703615 CATGAGAGGGACCCGGTGGGAGG + Intronic
1086620769 11:88884661-88884683 CATGAGAGGGACCCAGTGGGAGG + Intronic
1087086954 11:94229639-94229661 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1087211109 11:95447063-95447085 CATCAGAGGGAGGCCGAGGTGGG - Intergenic
1087286332 11:96268648-96268670 CATGGGAGGGACCCAGTGGGAGG + Intronic
1087385371 11:97462868-97462890 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1087453462 11:98353589-98353611 CATGGGAGGGAGATTGAGGGAGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087675750 11:101159035-101159057 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1087973393 11:104513746-104513768 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1088388975 11:109292185-109292207 CGTGAGAGGGACTCGGTGGGAGG + Intergenic
1088883443 11:113989419-113989441 CAAGAGAGGGAGACCCCGGGTGG - Intronic
1089190231 11:116648405-116648427 CTTGAGAGGGAGGACCTGGGAGG - Intergenic
1089352272 11:117828423-117828445 CATGTGAGGGAGACCTTTAGGGG + Intronic
1089500928 11:118930730-118930752 TATTAGATGGAGACCCTGGGAGG - Intronic
1089923940 11:122237755-122237777 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1090667662 11:128925486-128925508 CATGAAAGGGAGAGGGTGGGAGG - Intergenic
1090687446 11:129139533-129139555 CATGGGAGGGACCCAGTGGGAGG + Intronic
1090791338 11:130092683-130092705 CATGAGAGGGAGACCGTGGGGGG + Intronic
1090903193 11:131050494-131050516 CATGGGAGGGACCCGGTGGGAGG + Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1090955934 11:131512851-131512873 CAAGACAGGGAGAGGGTGGGGGG - Intronic
1091811741 12:3405294-3405316 CATGGGAGGGACCCGGTGGGAGG - Intronic
1092030363 12:5278622-5278644 GATGTGAGGGAGAGAGTGGGCGG - Intergenic
1092050724 12:5467994-5468016 CATCAGAGGGAAAATGTGGGGGG - Intronic
1092452282 12:8614129-8614151 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092618056 12:10233749-10233771 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1092656189 12:10687555-10687577 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1092795774 12:12109185-12109207 CATGAGAGGGACCTGGTGGGAGG - Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1092830209 12:12437141-12437163 CATGGGAGGGACCCAGTGGGAGG + Intronic
1092870427 12:12801116-12801138 CAAGAGATTGAGACCTTGGGAGG + Intronic
1093162440 12:15764267-15764289 CATGAGAGGGACCCGGTGGGAGG - Intronic
1093313081 12:17616579-17616601 CATGGGAGGGACTCAGTGGGAGG - Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094266552 12:28566374-28566396 CATGGGAGGGACCCGGTGGGAGG - Intronic
1094575740 12:31683511-31683533 CGTGAGAGGGACCCGGTGGGAGG + Intronic
1094595286 12:31859940-31859962 CATGGGAGGGACCCTGTGGGAGG - Intergenic
1094622505 12:32093685-32093707 CATGGGAGGGACCCGGTGGGAGG + Intergenic
1094704270 12:32899160-32899182 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1094716041 12:33016269-33016291 CATGGGAGGAAGCCGGTGGGAGG + Intergenic
1094793932 12:33948853-33948875 CATGAGAGGAACCCGGTGGGAGG + Intergenic
1094814361 12:34168746-34168768 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1095105798 12:38231434-38231456 CATGAGAGGAACCCGGTGGGAGG + Intergenic
1095188836 12:39232698-39232720 CATGAGAGGGACCCAGTGGGAGG - Intergenic
1095640757 12:44482834-44482856 CATGGGAGGGACCCGGTGGGAGG - Intergenic
1095641019 12:44484770-44484792 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1096245966 12:49986679-49986701 CATGGGAGGGACCCAGTGGGAGG - Intronic
1096471799 12:51882633-51882655 CATGGGAGGGATCCAGTGGGAGG - Intergenic
1096924026 12:55122191-55122213 CATGAGAGAGAGATAGTGAGGGG + Intergenic
1097018215 12:56002166-56002188 CAAGATAGGGAGACCCTGGGAGG - Exonic
1097617924 12:61906269-61906291 CATGGGAGGGACCCAGTGGGAGG + Intronic
1097618191 12:61908247-61908269 CATGGGAGGGACCCAGTGGGAGG + Intronic
1097744942 12:63291300-63291322 CATGGGAGGGAGCTGGTGGGAGG + Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098461277 12:70735507-70735529 CATGGGAGGGACCCAGTGGGAGG - Intronic
1098526313 12:71490958-71490980 CATGAGAGGGACCTGGTGGGAGG + Intronic
1098529843 12:71529343-71529365 CAGGAGAGAGAGAGCGAGGGGGG + Intronic
1098578344 12:72070215-72070237 CATGGGAGGGACCCAGTGGGAGG - Intronic
1098719957 12:73883943-73883965 CCTGGGAGGGACACGGTGGGGGG + Intergenic
1098763421 12:74453823-74453845 CATGAGAGGGACCTGGTGGGAGG - Intergenic
1099768953 12:87028138-87028160 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1099786416 12:87269665-87269687 CAAGAGAGGGAGAGAGTGTGAGG + Intergenic
1099826312 12:87781246-87781268 CATGGGAGGGACCCGGTGGGAGG - Intergenic
1099869545 12:88329390-88329412 TATGGGAGGGACACAGTGGGAGG - Intergenic
1099871792 12:88358867-88358889 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1100147640 12:91697702-91697724 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1100182461 12:92100337-92100359 CATGGGAGGGACCCGGTGGGAGG - Intronic
1100273182 12:93045739-93045761 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1100672498 12:96832025-96832047 CATGAGAGGAACCCAGTGGGAGG + Intronic
1100674740 12:96855190-96855212 CATGAGAGGGACCTGGTGGGAGG - Intronic
1100695072 12:97083995-97084017 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1100722853 12:97377090-97377112 CATGGGAGGGACTCGGTGGGAGG - Intergenic
1100774364 12:97958094-97958116 CAGGAGATGGAGACCTTGGCGGG + Intergenic
1100932864 12:99630905-99630927 CATGGGAGGGACCCAGTGGGAGG + Intronic
1101192926 12:102353830-102353852 CATGGGAGGGATCCAGTGGGAGG - Intergenic
1101272389 12:103161417-103161439 CAAGAGAGGGAGATGGTAGGTGG - Intronic
1101372890 12:104146008-104146030 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1101476179 12:105050865-105050887 CATGGGAGGGACCCAGTGGGAGG - Intronic
1101541432 12:105669147-105669169 CATGGGAGGGATCCAGTGGGAGG - Intergenic
1101684348 12:107002738-107002760 CATGGGAGGGACCCTGTGGGAGG + Intronic
1101684836 12:107008742-107008764 CATGGGAGGGACCCAGTGGGAGG + Intronic
1101694634 12:107113534-107113556 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1101757926 12:107635769-107635791 AATGAGAAGGAGACAGTGAGGGG + Intronic
1101977195 12:109370072-109370094 CATGGGAGGGACATGGTGGGAGG - Intronic
1102079405 12:110085902-110085924 CCTGAGAGGGAGAAAGTGGAAGG + Intergenic
1102395389 12:112581392-112581414 CATGGGAGGGACCCAGTGGGAGG - Intronic
1102444203 12:112989109-112989131 CATGGGAGGGACCCAGTGGGAGG + Intronic
1102907794 12:116690370-116690392 CAAGAGAGGAACACAGTGGGGGG - Intergenic
1103045225 12:117730501-117730523 AGGGAGAGGGAGACCGTGGAAGG - Intronic
1103127933 12:118440630-118440652 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1103463492 12:121123523-121123545 CCTGAGAGGGAGAAAGTGGAAGG - Intergenic
1104112420 12:125716507-125716529 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1104170918 12:126279542-126279564 CATGAGAGGGACCCGGTGGGAGG + Intergenic
1104268315 12:127259160-127259182 CATGGGAGGGACCCGGTGGGAGG - Intergenic
1104343391 12:127973223-127973245 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1104411074 12:128558318-128558340 CATGGGAGGGACCCGGTGGGAGG + Intronic
1104438850 12:128778736-128778758 CATGGGAGGGACTCTGTGGGAGG - Intergenic
1104491668 12:129199842-129199864 CATGCGAGGGACCCAGTGGGAGG - Intronic
1104573737 12:129948009-129948031 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1104741928 12:131184070-131184092 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1104742480 12:131188630-131188652 CATGGGAGGGAGGCTGAGGGGGG + Intergenic
1105693983 13:22870510-22870532 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1105753038 13:23439598-23439620 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1105806675 13:23955495-23955517 CAGGAGAGGGAAAAAGTGGGTGG + Intergenic
1106009232 13:25802005-25802027 CATGGGAGGGACCCGGTGGGAGG - Intronic
1106340704 13:28823985-28824007 CATGAGAGGGACTAGGTGGGAGG - Intronic
1106352016 13:28940040-28940062 CATGGGAGGGAACCAGTGGGAGG - Intronic
1106418812 13:29568751-29568773 CATGAGACTGAGACCTTGTGTGG + Intronic
1106475536 13:30095096-30095118 CATGGGAGGGACACTGTGGGAGG + Intergenic
1107515632 13:41125985-41126007 CATGGGAGGGACCCGGTGGGAGG + Intergenic
1107595278 13:41957173-41957195 CATGGGAGGGACCCAGTGGGAGG + Intronic
1107702455 13:43061643-43061665 CAAGAGAGGGAGAGTGTGGTGGG + Intronic
1108185764 13:47887058-47887080 CATGGGAGGGACCCGGTGGGAGG - Intergenic
1108686629 13:52825822-52825844 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1108790540 13:53965187-53965209 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1108790817 13:53967118-53967140 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1108821395 13:54354948-54354970 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1108844396 13:54660145-54660167 CATGTGAGGGAGACTGAGGGAGG - Intergenic
1108874339 13:55026008-55026030 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1108875249 13:55039669-55039691 CATGGGAGGGACATGGTGGGAGG + Intergenic
1109094561 13:58096524-58096546 CCTGAGAGGGACCCGGTGGGAGG + Intergenic
1109216619 13:59596869-59596891 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1109245978 13:59955256-59955278 CATGGGAGGGACCCAGTGGGAGG + Intronic
1109489479 13:63077104-63077126 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1109697462 13:65978678-65978700 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1109750647 13:66686175-66686197 CATGAGAGGGACCCAGTGGGAGG + Intronic
1109771938 13:66986271-66986293 CATGGGAGGGACATGGTGGGAGG - Intronic
1109790104 13:67235401-67235423 AATTAGAGGGGGACTGTGGGGGG - Intergenic
1109960579 13:69623759-69623781 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1110073293 13:71206580-71206602 CGTGAGAGGGACCCAGTGGGAGG + Intergenic
1110156777 13:72326413-72326435 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1110342682 13:74411783-74411805 CATGGGAGGGACTCTGTGGGAGG + Intergenic
1110695620 13:78484733-78484755 CATGAGAGGGACCCGGTGGAGGG + Intergenic
1110970352 13:81753815-81753837 CATGAGAGGGACCCAGTGGGAGG + Intergenic
1111204663 13:84990010-84990032 CATGGGAGGGGCCCCGTGGGAGG - Intergenic
1111260780 13:85737471-85737493 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1111285663 13:86089034-86089056 CATGGGAGGGATCCAGTGGGAGG - Intergenic
1111457596 13:88505457-88505479 CATGAGAGGGACCCAGTGGGAGG + Intergenic
1111505353 13:89182968-89182990 CATGAGAGGGACTTGGTGGGAGG - Intergenic
1111627524 13:90808307-90808329 CATGAGAGGGAACTGGTGGGAGG - Intergenic
1111697932 13:91648965-91648987 CATGGGAGGGACCCAGTGGGAGG + Intronic
1111891698 13:94090290-94090312 CATGGGAGGGATCCGGTGGGAGG - Intronic
1111919785 13:94397876-94397898 CATGAGAGGGAACTGGTGGGAGG + Intronic
1112162923 13:96888316-96888338 CATGGGAGGGATCCAGTGGGAGG - Intergenic
1112401935 13:99085826-99085848 AAGGAGAGGGAGGCCGGGGGAGG + Intronic
1112887957 13:104196870-104196892 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1112900307 13:104350382-104350404 CATGAGAGGGACCCGGTGGGAGG - Intergenic
1113181669 13:107635443-107635465 CATGAGAGGGGCCCAGTGGGAGG - Intronic
1113229721 13:108199205-108199227 CATGGGAGGGACCCGGTGGGAGG - Intergenic
1113249355 13:108434509-108434531 CATGAGAGGGACCCAGTGGGAGG + Intergenic
1113522333 13:110949758-110949780 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1114680618 14:24481114-24481136 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1114778547 14:25513985-25514007 CATGGTAGGGACACAGTGGGAGG - Intergenic
1114792265 14:25672904-25672926 AATGAGAGAGAGAACGAGGGAGG + Intergenic
1114927353 14:27421066-27421088 CATGGGAGGGAAATTGTGGGAGG - Intergenic
1114975972 14:28099914-28099936 CATGAGAGGGACCCAGTGGGAGG + Intergenic
1115359091 14:32481648-32481670 CATGGGAGGGACCCGGTGGGAGG - Intronic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1115718309 14:36130305-36130327 CATGGGAGGGAGCCTGTGGGAGG + Intergenic
1116589771 14:46757192-46757214 CATGAGAGGGACCCAGTGGGAGG + Intergenic
1116669896 14:47828215-47828237 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1116715400 14:48419702-48419724 CATGGGAGGGAACCAGTGGGAGG + Intergenic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1117291307 14:54336308-54336330 CATGGGAGGGACCCCATGGGAGG + Intergenic
1117504142 14:56384917-56384939 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1117673057 14:58127268-58127290 CATGGGAGGGACCCAGTGGGAGG + Intronic
1117745192 14:58861914-58861936 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1117837366 14:59820693-59820715 CATGTGAGGGACTCCATGGGAGG - Intronic
1118062181 14:62151591-62151613 CATGAGAGGGAGAAAGGAGGGGG + Intergenic
1118064714 14:62178620-62178642 CATGGGAGGGACTCGGTGGGAGG - Intergenic
1118661273 14:68015660-68015682 CATGGGAGGGACCCAGTGGGAGG - Intronic
1118668873 14:68101156-68101178 CATGAGAGGGACCTGGTGGGAGG - Intronic
1118669160 14:68103081-68103103 CATGGGAGGGACCCAGTGGGAGG - Intronic
1118734579 14:68692146-68692168 GATGAGAGGGAGACTGGGGGCGG - Intronic
1118992046 14:70806223-70806245 CATCAGAGGGTGAACATGGGCGG - Intronic
1119257229 14:73208932-73208954 CATGGGAGGGAGACTGAGGAGGG - Intronic
1119327415 14:73769100-73769122 GATGCGAGGGAGACCCTGGGAGG - Intronic
1119377820 14:74208886-74208908 CATGGGAGGGAGCACGTGGTGGG + Intergenic
1119406403 14:74402226-74402248 CAGGAGAGGGAAACACTGGGAGG + Intergenic
1119838711 14:77774242-77774264 CATGGGAGGGACCCCGTGGGAGG - Intergenic
1119917310 14:78413887-78413909 CATGAGAGGGACCCTGTGGGAGG + Intronic
1119942111 14:78651820-78651842 CGTGGGAGGGAGCCAGTGGGAGG - Intronic
1119943354 14:78665481-78665503 CATGAGAGGAACCCGGTGGGAGG - Intronic
1120100413 14:80438505-80438527 CAAGAGAGAGAGAGAGTGGGTGG - Intergenic
1120283388 14:82466745-82466767 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1120346579 14:83298309-83298331 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1120665350 14:87300053-87300075 TGTGAGAGGGACCCCGTGGGAGG + Intergenic
1120933969 14:89875326-89875348 CATGGGAGGGACCCAGTGGGAGG - Intronic
1120956882 14:90090698-90090720 CATGAGAGGAACCCAGTGGGAGG + Intronic
1121210810 14:92206969-92206991 AATGAGAGGGAGGGTGTGGGTGG + Intergenic
1121318441 14:92975853-92975875 CATGGGAGGGAGCCGGTGGGAGG + Intronic
1121421889 14:93821764-93821786 CATGGGAGGGACTCAGTGGGAGG + Intergenic
1121471026 14:94154480-94154502 CATGGGAGGGACCCAGTGGGAGG + Intronic
1121490142 14:94352509-94352531 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1121506146 14:94479077-94479099 CATGGGAAGGAGAAAGTGGGAGG + Intronic
1121515550 14:94547543-94547565 CATGGGAGGGACCCGGTGGGAGG + Intergenic
1121895521 14:97643443-97643465 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1122440452 14:101728099-101728121 CATGGGAGGGACCCGGTGGGAGG + Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122658306 14:103277973-103277995 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1122986046 14:105212071-105212093 CAGGGCAGGGAGACCTTGGGAGG - Intronic
1123055401 14:105566906-105566928 CATGGGAGGGGGTCCCTGGGTGG - Intergenic
1123079853 14:105686750-105686772 CATGGGAGGGGGTCCCTGGGTGG - Intergenic
1123737427 15:23199341-23199363 CATGAAAGGGACCCAGTGGGAGG - Intergenic
1124066160 15:26346004-26346026 CATGGGAGGGATCCAGTGGGAGG + Intergenic
1124226390 15:27898328-27898350 CATGGGAGGAACACAGTGGGAGG + Intronic
1124288641 15:28428004-28428026 CATGAAAGGGACCCAGTGGGAGG - Intergenic
1124294585 15:28489310-28489332 CATGAAAGGGACCCAGTGGGAGG + Intergenic
1124845707 15:33287955-33287977 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1125471966 15:40013695-40013717 CATGGGAGGGACCCAGTGGGAGG - Intronic
1125472239 15:40015536-40015558 CATGGGAGGGATCCAGTGGGAGG - Intronic
1125751246 15:42030578-42030600 TGTGAGAGGGAGATGGTGGGAGG + Intronic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1126190691 15:45874859-45874881 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126705465 15:51401519-51401541 CTTGGGAGGGAGTCCTTGGGAGG - Intronic
1126824939 15:52539642-52539664 CATGAGAGGGACCCCATGGGAGG - Intergenic
1126933193 15:53677506-53677528 CTTGGGAGGGACCCCGTGGGAGG + Intronic
1126942961 15:53785903-53785925 CATGGGAGGGATCCAGTGGGAGG - Intergenic
1126990891 15:54374386-54374408 CATGAGAGGGAGGCCGGGGTGGG - Intronic
1127186542 15:56486251-56486273 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1127286880 15:57540481-57540503 CATGGGAGGGACCCAGTGGGAGG - Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128470864 15:67951327-67951349 CATGGGAGGGACCCTGTGGGAGG + Intergenic
1129118935 15:73383186-73383208 TATAAGAGGGAGACAGAGGGAGG + Intergenic
1129479364 15:75810822-75810844 CAAGAGAGGGAGACTGTGCTGGG - Intergenic
1129883742 15:79024546-79024568 CATGGGAGGGACCCAGTGGGAGG + Intronic
1130060073 15:80563389-80563411 CATGGGAGGGAGACAGTGATGGG - Intronic
1130134383 15:81169745-81169767 CATGAGAGGGAGCACGCAGGTGG - Intronic
1130706923 15:86241945-86241967 CATGGGAGGGACCCAGTGGGAGG + Intronic
1130820625 15:87491355-87491377 CATGGGAGGGAGTCGGTGGGAGG + Intergenic
1130971077 15:88733178-88733200 CATGGGAGGGACCCGGTGGGAGG + Intergenic
1130982281 15:88821105-88821127 CATGGGAGGGACCCAGTGGGAGG - Intronic
1131240765 15:90740693-90740715 CATGGGAGGGACCTCGTGGGAGG + Intronic
1132259179 15:100407054-100407076 CATGGGAGGGACCCAGTGGGAGG - Intronic
1132299318 15:100766561-100766583 CATGAGACAGAGATGGTGGGGGG + Intergenic
1132416703 15:101625469-101625491 CATGGGAGGGACCCAGTGGGAGG - Intronic
1133365206 16:5203715-5203737 CATCAGAAGGAGACCGTGGAGGG + Intergenic
1133509561 16:6444398-6444420 CATGGGAGGGAACCCGTGGGAGG + Intronic
1133537100 16:6712842-6712864 CATGGGAGGGACCCAGTGGGAGG + Intronic
1133618307 16:7500844-7500866 CGTGAGAGGGACCCGGTGGGAGG + Intronic
1133693274 16:8236573-8236595 CATGAGAGGGACCCAGTGGACGG - Intergenic
1133704932 16:8345251-8345273 CATGAGAGGGATCCAGTGGGAGG + Intergenic
1133752566 16:8736217-8736239 CATGGGAGGGACCCAGTGGGAGG - Intronic
1133903335 16:9997709-9997731 CATGGGAGGGACCCAGTGGGAGG + Intronic
1133947395 16:10360679-10360701 CAAGAGAGGGATCCGGTGGGAGG + Intronic
1134015854 16:10887783-10887805 CATGAGAAGGAGGCCAGGGGTGG - Intronic
1134350909 16:13437066-13437088 CATGGGAGGGACCCGGTGGGAGG - Intergenic
1134391477 16:13824027-13824049 CATGGGAGGGATCCAGTGGGAGG + Intergenic
1134564449 16:15239165-15239187 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1134600596 16:15530665-15530687 CATGAGAGGGACCCGGTGGAAGG + Intronic
1134738046 16:16517534-16517556 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1134778963 16:16878097-16878119 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1134782581 16:16911743-16911765 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1134907457 16:17992907-17992929 CATGGGAGGGACCCGGTGGGAGG + Intergenic
1134929454 16:18194628-18194650 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1135079389 16:19421326-19421348 CATGAGAGGGACGCTGTGGGAGG + Intronic
1135424011 16:22323424-22323446 CTTGGGAGGGAGGCCATGGGTGG - Intronic
1135485374 16:22860378-22860400 CATGGGAGGGACCCAGTGGGAGG - Intronic
1135681905 16:24464640-24464662 CATGGGAGGGACGCTGTGGGAGG + Intergenic
1135804317 16:25528374-25528396 CATGGGAGGGATCCAGTGGGAGG + Intergenic
1135806209 16:25545291-25545313 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1135915786 16:26604317-26604339 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1135933472 16:26759394-26759416 CATGGGAGGGACTCAGTGGGAGG - Intergenic
1136085517 16:27882078-27882100 CATGGGAGGGACCCAGTGGGAGG + Intronic
1136377936 16:29876544-29876566 GATGAGAGGGAGACCCAGAGGGG + Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137524769 16:49225047-49225069 CATGAGAGGGACCCGGAGGGAGG - Intergenic
1137862108 16:51856863-51856885 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1138101774 16:54257686-54257708 CATGGGAGGGACCCAGTGGGCGG + Intronic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1138728434 16:59166597-59166619 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1138745756 16:59361814-59361836 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1138895567 16:61199547-61199569 CATGAGAGGAAGCCAGTGGGAGG + Intergenic
1139196151 16:64920768-64920790 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1139220728 16:65178938-65178960 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1139222598 16:65199502-65199524 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1139309923 16:66019595-66019617 CATGGGAGGGACCCTGTGGGGGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140206802 16:72939884-72939906 CATGAGAGGGCTGCGGTGGGAGG - Intronic
1140431430 16:74907325-74907347 CAAGGGAGGGACACAGTGGGAGG + Intronic
1140697762 16:77551817-77551839 GAAGAGAGGGAGAGGGTGGGAGG + Intergenic
1140823964 16:78688806-78688828 CATGGGAGGGACCCAGTGGGAGG + Intronic
1140826797 16:78714453-78714475 CATGGGAGGGACTCGGTGGGAGG - Intronic
1140939743 16:79710196-79710218 CATGAGAGGGACCCAGTGGGAGG + Intergenic
1140991683 16:80219193-80219215 CATGAGAGGGACTCTGTGGGAGG + Intergenic
1141000490 16:80302932-80302954 CATGAGAGGGACCCCGTGGGAGG + Intergenic
1141342821 16:83218795-83218817 CATGGGAGGGACCCAGTGGGAGG + Intronic
1141859322 16:86705662-86705684 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1141939108 16:87262915-87262937 CATCAAAGGGATACCGTGTGAGG + Intronic
1203142322 16_KI270728v1_random:1776257-1776279 CATGAGAGGGACCCAGTGGGAGG + Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143305879 17:5946293-5946315 TATGAGAGGGACCCAGTGGGAGG + Intronic
1143335767 17:6170505-6170527 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1143377253 17:6474096-6474118 CAGGAGAAGGAGAGGGTGGGAGG + Intronic
1144299865 17:13913120-13913142 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1146091695 17:29885700-29885722 GATGGGAGGGAGCCAGTGGGAGG + Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146452157 17:32983129-32983151 CATGGGAGGGACCCAGTGGGAGG - Intronic
1146936268 17:36814321-36814343 CATTCGAGGGAGACAGTGTGCGG + Intergenic
1147122514 17:38343903-38343925 CGTGAGAGGGAGACGGAGAGAGG - Intergenic
1147477322 17:40724516-40724538 CATGGGAGGGACTCAGTGGGAGG + Intergenic
1147520661 17:41169269-41169291 CATGGGAGGGACCCGGTGGGAGG + Intergenic
1147834196 17:43318351-43318373 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1148244105 17:46019303-46019325 CATGGGAGGGACCCAGTGGGAGG - Intronic
1148390671 17:47270119-47270141 CATGAGAGGGACTCAGTGGGAGG - Intronic
1149052582 17:52324858-52324880 CATGAAAGGGACCCAGTGGGAGG - Intergenic
1149109352 17:53008615-53008637 CATGAGAGGGACCCAGTGGGAGG - Intergenic
1149190190 17:54051584-54051606 CATGAGAGGGACCCAGTGGGAGG - Intergenic
1149292574 17:55231737-55231759 CATGAAAGGGAGTCCGGGGATGG - Intergenic
1149363501 17:55917578-55917600 CGTGAGAGGGACCCAGTGGGAGG + Intergenic
1149370087 17:55985355-55985377 CATGGGAGGGACACAGTGGAAGG - Intergenic
1149401886 17:56305245-56305267 CATGGGAGGGAGCCAGTGGGAGG - Intronic
1149735881 17:58993024-58993046 CATGGGAGGGACCCAGTGGGAGG + Intronic
1150146270 17:62772166-62772188 CATGGGAGGGACCCGGTGGGAGG + Intronic
1150215711 17:63467849-63467871 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1150874832 17:68959203-68959225 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1151044946 17:70908919-70908941 CAATAGAGTGAGACCCTGGGAGG - Intergenic
1151121241 17:71795855-71795877 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1151536508 17:74741914-74741936 CAGGAGAGGGAGACCGAAGTGGG + Intronic
1151762407 17:76113078-76113100 CATGGGAGGGACCCAGTGGGAGG + Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152104020 17:78318534-78318556 CATCAGAGGGTGACCCTGGGAGG + Intergenic
1152530315 17:80914718-80914740 CATGGGAGGGAGGCTGAGGGTGG + Intronic
1152632667 17:81417511-81417533 CAGGGGAGGGAGACCGAGGAGGG + Intronic
1152771904 17:82175207-82175229 CATGAGGGGTAGACCCTGGAAGG + Intronic
1153007805 18:512993-513015 CTTGAGAGGGAGACCGTGGAAGG + Intergenic
1153087800 18:1308214-1308236 CATAAGAGGGACCCAGTGGGGGG + Intergenic
1153182877 18:2455673-2455695 CATGGGAGGGATCCAGTGGGAGG + Intergenic
1153348491 18:4053431-4053453 CATGGGAGGGACTCAGTGGGAGG - Intronic
1153537979 18:6123378-6123400 CATGGGAGGGACCCAGTGGGAGG + Intronic
1153608132 18:6855021-6855043 CATGGGAGGGAGGCCGAGGTGGG + Intronic
1155722805 18:29039760-29039782 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1155731991 18:29172082-29172104 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1156031820 18:32721959-32721981 CATGGGAGGGATCCGGTGGGAGG + Intronic
1156090322 18:33460293-33460315 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1156243730 18:35277434-35277456 CATGAGAGGGACCCAGTGGGAGG + Intronic
1156315639 18:35966526-35966548 AATGAGAGAGAGGCCCTGGGAGG - Intergenic
1156382680 18:36578412-36578434 CATGGGAGGGACCCAGTGGGAGG - Intronic
1156668843 18:39442733-39442755 CATGAGAGGGACACAGTGCGAGG + Intergenic
1156875117 18:42000857-42000879 TATGAGAGGGACATGGTGGGAGG - Intronic
1158008450 18:52700517-52700539 CATGAAAAGGAGCCTGTGGGGGG - Intronic
1158195187 18:54877027-54877049 CATGGGAGGGACCCAGTGGGAGG + Intronic
1158218631 18:55127177-55127199 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1158311546 18:56165004-56165026 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1158321990 18:56273620-56273642 CATGAGAGGGACTCAGTGGGAGG + Intergenic
1158488694 18:57891004-57891026 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1158566689 18:58560116-58560138 CATGGGAGGGACCCAGTGGGAGG + Intronic
1158639175 18:59188776-59188798 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1158812852 18:61057846-61057868 CATGAGAGGGGCTCCGTGGGAGG + Intergenic
1159151910 18:64532800-64532822 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1159512144 18:69409032-69409054 CATGGGAGGGACCCGGTGGGAGG + Intronic
1159583680 18:70262490-70262512 CATGGGAGGGAGTCAGTGGGAGG + Intergenic
1159634665 18:70790091-70790113 CATGAGAGGGAGCTGGTGGAAGG - Intergenic
1159769007 18:72526824-72526846 CATGAGAGGGACCCAGTGGGAGG + Intergenic
1159835599 18:73331257-73331279 CCTGAGAGGGACCCAGTGGGAGG - Intergenic
1159888329 18:73931722-73931744 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1160042102 18:75354345-75354367 CATGGGAGGGACCCGGTGGGAGG + Intergenic
1160547600 18:79670718-79670740 CATGGGAGGGACCCGGTGGGAGG + Intergenic
1160627057 18:80218025-80218047 CATGAGAGGGATCTGGTGGGAGG - Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163053691 19:14703299-14703321 CATGGGAGGGACCCGGTGGGAGG - Intronic
1163076998 19:14902419-14902441 CATGGGAGGGACCCGGTGGGAGG - Intergenic
1163170964 19:15530800-15530822 CATGCGAGGGATCCGGTGGGGGG - Intronic
1163227528 19:15974938-15974960 CATGGGAGGGATCCAGTGGGAGG + Intergenic
1163239033 19:16047806-16047828 AATGAGAGGGACTCAGTGGGAGG + Intergenic
1164458500 19:28428179-28428201 CGAGAGAGGGAGGCCGTGAGAGG + Intergenic
1164859355 19:31550554-31550576 CATGAGAGGGATCCAATGGGAGG - Intergenic
1164892896 19:31840103-31840125 CATGGGAGGGACCCGGTGGGAGG - Intergenic
1164911534 19:32016230-32016252 CATCAGAGGGACCCAGTGGGAGG + Intergenic
1165094673 19:33403573-33403595 CATGGGAGGGAGCCAGGGGGTGG + Intronic
1165147253 19:33738931-33738953 CTAGAGAGGGAGATGGTGGGTGG + Intronic
1165243322 19:34483507-34483529 CTGGAGAGGGAGACTGTGTGAGG + Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166599537 19:44081835-44081857 CATAAGAGGGAGCTGGTGGGAGG - Intronic
1166657907 19:44625779-44625801 CATGAGAGGGACCCGGTAGGAGG + Intronic
1166900456 19:46057899-46057921 CATGGGAGGGATGCAGTGGGAGG - Intronic
1166983769 19:46648102-46648124 AATGAGAGGGAGAGCGGTGGAGG + Exonic
1167588871 19:50391669-50391691 CATCAGAGGGAGACTGAGAGGGG + Intronic
1167768986 19:51502009-51502031 ACTGAGAGGGAGGCAGTGGGCGG - Intergenic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168273354 19:55262403-55262425 GATGAGAGTGAGAGCATGGGAGG + Exonic
1168561432 19:57387072-57387094 CAAGAGAGGAGGACAGTGGGTGG - Intronic
924970799 2:126228-126250 CATGAGAGGGAAACTGTGGAAGG - Intergenic
925035552 2:682605-682627 CATGGGAGGGACCCCATGGGTGG + Intergenic
925299593 2:2801132-2801154 CATGAGAGGGACCCAGTGAGAGG + Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925476504 2:4222588-4222610 CATGGGAGGGACCCTGTGGGAGG - Intergenic
925590187 2:5501644-5501666 CATGGGAGGGACCCAGTGGGAGG + Intergenic
925846309 2:8037199-8037221 CATGGGAGGGACCCAGTGGGAGG - Intergenic
926008505 2:9390675-9390697 CATGGGAAGGAGTCGGTGGGAGG + Intronic
926111232 2:10185297-10185319 CAGGAGAGGCTGAGCGTGGGAGG + Intronic
926347871 2:11965932-11965954 CAGGAGGCGGAGACTGTGGGTGG - Intergenic
926354014 2:12023233-12023255 CATGGGAGGGACCCAGTGGGAGG + Intergenic
926483836 2:13431628-13431650 CATGGGAGGGACCCGGTGGGAGG - Intergenic
926677105 2:15634867-15634889 CAGGAGTGGGAGCCCATGGGAGG - Intergenic
926744104 2:16136346-16136368 CATGGGAGGGACCCAGTGGGAGG + Intergenic
926841043 2:17080438-17080460 CATGGGAGGGACTCAGTGGGAGG + Intergenic
927294439 2:21438202-21438224 CATGGGAGGGATCCAGTGGGAGG + Intergenic
927532288 2:23818250-23818272 GAAGAGAGGGAGACGGAGGGAGG + Intronic
927899045 2:26805837-26805859 CATGGGAGGGACCCAGTGGGAGG - Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928324165 2:30306739-30306761 CATGGGAGGGACCCAGTGGGAGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928605768 2:32944327-32944349 CGTGGGAGGGAGCCGGTGGGAGG + Intergenic
928695285 2:33842825-33842847 CATGGGAGGGACCCAGTGGGAGG + Intergenic
928899829 2:36304972-36304994 CATGGGAGGAAGAGCGAGGGAGG - Intergenic
929019685 2:37539211-37539233 CATGGGAGGGACTCGGTGGGAGG + Intergenic
929029050 2:37633892-37633914 CATGGGAGGGACCCAGTGGGAGG + Intergenic
929085559 2:38164189-38164211 CATGGGAGGGACCCAGTGGGAGG + Intergenic
929275426 2:40020238-40020260 CATGGGAGGGACCCAGTGGGAGG + Intergenic
929302487 2:40321752-40321774 CATGGGAGGGACTCAGTGGGAGG - Intronic
929345908 2:40884541-40884563 CATGAGAGGGACCCGGTGGGAGG + Intergenic
929493018 2:42413860-42413882 CATGAGAGGGACCCAGTGGGAGG - Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930081330 2:47451403-47451425 CATGGGAGGGACCCGGTGGGAGG - Intronic
930153941 2:48086226-48086248 CATGGGAGGGACCCTGTGGGAGG - Intergenic
930229983 2:48833841-48833863 CATGTGAGGGACCCAGTGGGGGG + Intergenic
930269806 2:49242553-49242575 CATGGGAGGGATCCAGTGGGAGG - Intergenic
930446706 2:51482536-51482558 CATGAGAGGGACCCAGTGGGAGG + Intergenic
930514750 2:52392951-52392973 CATGAGACGGACATGGTGGGAGG - Intergenic
930522006 2:52479406-52479428 CATGAAAGGGACCCAGTGGGAGG + Intergenic
930942006 2:57025025-57025047 CATGGGAGGGACCCAGTGGGAGG - Intergenic
931060953 2:58529538-58529560 CATGGGAGGGACCCGGTGGGAGG + Intergenic
931079301 2:58751739-58751761 CATGGGAGGGACCCAGTGGGAGG + Intergenic
931083642 2:58804400-58804422 CATGGGAGGGGGCCAGTGGGAGG - Intergenic
931119249 2:59198225-59198247 CATGGGAGGGACTCGGTGGGAGG + Intergenic
931395902 2:61888367-61888389 CATGAGAGTGATACCTTTGGCGG + Exonic
931445953 2:62327452-62327474 CATGGGAGGGACCCCATGGGAGG - Intergenic
931824782 2:65989178-65989200 CACGAGAGGGACCCAGTGGGAGG - Intergenic
931835816 2:66097524-66097546 CATGAGAGGGACCTTGTGGGGGG - Intergenic
932077803 2:68681422-68681444 CATGGGAGGGACCCAGTGGGAGG - Intronic
932311852 2:70749266-70749288 CATGGGAGGGACCCTGTGGGAGG - Intronic
933139249 2:78773661-78773683 CATGGGAGGGACCCAGTGGGAGG + Intergenic
933190724 2:79330616-79330638 CATGAGAGGGACCCAGTAGGAGG + Intronic
933394099 2:81710314-81710336 CATGAGAGGGACCCAGTGGGAGG + Intergenic
933425728 2:82109861-82109883 CAAGGGAGGGACACGGTGGGAGG - Intergenic
933508261 2:83205462-83205484 CATGGGAGGGACCCAGTGGGAGG - Intergenic
933813463 2:86047865-86047887 CAGGAGAGGCAGAGCCTGGGTGG + Intronic
933937512 2:87218339-87218361 CATGGGAGGGACCCAGTGGGAGG - Intergenic
933943800 2:87267078-87267100 CATGGGAGGGACACAGTGGCAGG + Intergenic
934784865 2:96997681-96997703 CATGAGAGAGAGACGGGAGGGGG + Intronic
934918607 2:98321909-98321931 CATGGGAGGGACCCAGTGGGAGG + Intergenic
935149439 2:100420552-100420574 CATGGGAGGGACCCTGTGGGAGG + Intergenic
935157630 2:100497272-100497294 GAGGAGAGGGAGGCGGTGGGAGG - Intergenic
935245139 2:101212384-101212406 CATGGGAGGGACACAGTGGGAGG + Intronic
935385082 2:102491606-102491628 CATGGGAGGGACCCAGTGGGAGG - Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935800486 2:106690637-106690659 AATGAGAGGGAGCCAGTGGGAGG - Intergenic
935885525 2:107615251-107615273 CATGGGAGGGACCCTGTGGGAGG + Intergenic
936094874 2:109523839-109523861 TCTGAGAGGGAGACCGTCGCAGG - Intergenic
936175218 2:110213815-110213837 CATGGGAGGGACCCAGTGGGAGG - Intergenic
936336420 2:111594501-111594523 CATGGGAGGGACACAGTGGCAGG - Intergenic
936355629 2:111747463-111747485 CATGGGAGGGACCCAGTGGGAGG + Intergenic
936579976 2:113690938-113690960 CATGGGAGGGACCCGGTGGGAGG + Intergenic
936909582 2:117576318-117576340 CATGGGAGGGAACCTGTGGGAGG - Intergenic
936956159 2:118024295-118024317 TATGAGAGGGACACGGTGGGAGG + Intergenic
937031688 2:118746048-118746070 CATGAGAGGGACACAGTGGGAGG - Intergenic
937552678 2:123113760-123113782 CATGGGAGGGACCCAGTGGGAGG - Intergenic
937655263 2:124367486-124367508 CATGGGAGGGACCCAGTGGGAGG - Intronic
937658481 2:124403991-124404013 CATGAGAGGGACCCAGTGGGAGG - Intronic
937800440 2:126075651-126075673 TATGGGAGGGACCCCGTGGGAGG - Intergenic
937836812 2:126479416-126479438 CATGGGAGGGAGCCAGTGGGAGG + Intergenic
937935569 2:127241403-127241425 CATGGGAGGGACCCAGTGGGAGG - Intergenic
937957343 2:127428750-127428772 CCTGCGAGGGCGACAGTGGGGGG + Exonic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938770178 2:134494974-134494996 CCTGGGAGGGAGAACCTGGGAGG - Intronic
939226980 2:139377018-139377040 CATGGGAGGGAACCAGTGGGAGG - Intergenic
939237723 2:139519141-139519163 CATGGGAGGGACCCAGTGGGAGG + Intergenic
939287832 2:140155398-140155420 TATGGGAGGGACACAGTGGGAGG - Intergenic
939383599 2:141467176-141467198 CCTGAGAGAGAGAGCGCGGGGGG + Intronic
939647990 2:144724781-144724803 CATGGGAGGGACACAGTGGGAGG - Intergenic
939780946 2:146446742-146446764 CATGGGAGGGACCCAGTGGGAGG - Intergenic
939962746 2:148580115-148580137 CATGAGAGAGAGACCAAGTGAGG + Intergenic
940306379 2:152231771-152231793 CATGAGAGGGACCTCATGGGAGG + Intergenic
940505467 2:154547462-154547484 CATGAGAGGGACCTGGTGGGAGG + Intergenic
940621584 2:156120513-156120535 CATGAGAGGGACCCTGTGGGAGG + Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
940691134 2:156922605-156922627 CATGGGAGGGACCCAGTGGGAGG + Intergenic
941346371 2:164373368-164373390 CATGGGAGGGACCCGGTGGGAGG + Intergenic
941429672 2:165398860-165398882 CAGGAGAGGGAGAGAGTGTGAGG + Intergenic
941607785 2:167621659-167621681 CATGGGAGGGACCCAGTGGGAGG + Intergenic
942212136 2:173681837-173681859 CATGGGAGGGACCCTGTGGGAGG - Intergenic
942234458 2:173890389-173890411 CATGGGAGGGACTCAGTGGGAGG + Intergenic
942733231 2:179081978-179082000 CATGGGAGGGACACAGGGGGAGG - Intergenic
942950317 2:181713769-181713791 CATTAGAGGGACCCTGTGGGAGG + Intergenic
943041149 2:182807140-182807162 TATGAGAGGGAGAATGAGGGGGG - Intergenic
943145980 2:184045289-184045311 CATGGGAGGGACCCAGTGGGAGG - Intergenic
943183560 2:184575924-184575946 TATGAGAGGGACCCAGTGGGAGG - Intergenic
943411558 2:187555900-187555922 AGGGAGAGGGAGACCGTGAGAGG - Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
943744760 2:191450336-191450358 CATGGGAGGGACCCAGTGGGAGG + Intergenic
944097069 2:195980167-195980189 CATGGGAGGGACCCGGTGGGAGG + Intronic
944156050 2:196608968-196608990 CATGGGAGGGACCCAGTGGGAGG + Intergenic
944438301 2:199715334-199715356 CATGGGAGGGACCCAGTGGGAGG + Intergenic
944917673 2:204377748-204377770 CATGGGAGGGACCCAGTGGGAGG + Intergenic
944937813 2:204587783-204587805 CATGGGAGGGACCCAGTGGGAGG + Intronic
945006986 2:205419148-205419170 CATGGGAGGGACCCAGTGGGAGG + Intronic
945166789 2:206954957-206954979 CATGGGAGGGACTCTGTGGGAGG - Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945356059 2:208841205-208841227 CATGGGAGGGACCCGGTGGGAGG - Intronic
945360577 2:208891483-208891505 CATGGGAGGGACCCAGTGGGTGG + Intergenic
945456196 2:210055068-210055090 CATGGGAGGGACCCAGTGGGAGG + Intronic
945540152 2:211075532-211075554 CATGGGAGGGACCCAGTGGGAGG - Intergenic
945730120 2:213523115-213523137 CATGGGAGGGACCCAGTGGGAGG + Intronic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946475671 2:220004469-220004491 CATGAGAAGGATGCTGTGGGTGG + Intergenic
946496061 2:220196801-220196823 CATGGGAGGGACCCAGTGGGAGG - Intergenic
946803511 2:223446617-223446639 CATGGGAGGGATCTCGTGGGAGG + Intergenic
946824965 2:223668374-223668396 CATGAGAGGGACCTGGTGGGAGG - Intergenic
946831469 2:223732464-223732486 CATGGGAGGGACCCGGTGGGAGG - Intergenic
946931481 2:224675814-224675836 CATGGGAGGGACCCAGTGGGAGG - Intergenic
947048621 2:226017832-226017854 CATGGGAGGGACCCAGTGGGAGG - Intergenic
947070363 2:226281473-226281495 CATGGGAGGGAGCCAGTGGGAGG + Intergenic
947155546 2:227159582-227159604 CATGGGAGGGACCCAGTGGGAGG + Intronic
947276153 2:228395001-228395023 AATGAGAGGGACCCAGTGGGAGG - Intergenic
947396539 2:229693084-229693106 CATGGGAGGGACCCAGTGGGAGG + Intronic
947714858 2:232334327-232334349 CATGAGAGTGGGAGCCTGGGGGG - Intronic
948000288 2:234562189-234562211 CATCAGGGGGAGACCATGGAAGG - Intergenic
948450435 2:238067018-238067040 CATCAGAGGGACCCGGTGGGAGG - Intronic
948705056 2:239785698-239785720 CATGGGAGGGACCCGGTGGGAGG + Intronic
948760587 2:240188040-240188062 CATGTGAGGGACCCAGTGGGAGG + Intergenic
948899051 2:240946900-240946922 CATGAGGTGGAGAGTGTGGGCGG + Intronic
1168817656 20:751224-751246 CATGGGAGGGACCCCATGGGAGG + Intergenic
1168848229 20:959565-959587 CATGAGAGGGAGGCCTGTGGGGG + Exonic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169639266 20:7731651-7731673 CATGAGAGGGACCAAGTGGGAGG - Intergenic
1169817422 20:9672418-9672440 CATGGGAGGAAGCCTGTGGGAGG + Intronic
1169884534 20:10383800-10383822 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1170696476 20:18663916-18663938 CATGGGAGGGACCCAGTGGGAGG - Intronic
1171456718 20:25276519-25276541 CAGAAGGGGGAGACGGTGGGGGG + Intronic
1171946514 20:31383171-31383193 CATGGGAGGGACCCAGTGGGAGG + Intronic
1172396489 20:34609821-34609843 CATGAGAGGGACCCGGTGGGAGG + Intronic
1173158290 20:40633462-40633484 CATGTGGCGGAGACGGTGGGGGG - Intergenic
1173451130 20:43165032-43165054 CATGGGAGGGACCCAGTGGGAGG + Intronic
1173913057 20:46684590-46684612 CATGGGAGGGACCCAGTGGGAGG - Exonic
1173946687 20:46956990-46957012 CATGGGAGGGACCCAGTGGGAGG - Intronic
1173962000 20:47081186-47081208 CATGAGAGGAACCCAGTGGGAGG - Intronic
1173990808 20:47301855-47301877 CATGGGAGGGACCCAGTGGGAGG + Intronic
1174116443 20:48229744-48229766 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1174148035 20:48465791-48465813 CAGGAGAGGGAGACTTTGGGGGG + Intergenic
1174514323 20:51079820-51079842 CATGAGAGGGACCCAGTGGGAGG + Intergenic
1174581076 20:51572256-51572278 CATGGGAGGGATCCAGTGGGAGG - Intergenic
1174891953 20:54404826-54404848 CATGAGAGGGACCTGGTGGGAGG + Intergenic
1175408486 20:58750826-58750848 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1175730066 20:61348370-61348392 CATGGGAGGGACCCCGTGGGAGG - Intronic
1176137343 20:63530028-63530050 CATGAGAGGCAGAGTGGGGGAGG - Intronic
1176960652 21:15155145-15155167 CATGGGAGGGACGCAGTGGGAGG - Intergenic
1176975116 21:15312245-15312267 CAGGAGAGAGAGAGCGTGGAGGG - Intergenic
1177201668 21:17963607-17963629 CATGGGAGGGACCCAGTGGGAGG - Intronic
1177344681 21:19854079-19854101 CATGGGAGGGAGGCCGAGGTGGG - Intergenic
1177358212 21:20036483-20036505 CATGAGAGGAACCCAGTGGGAGG + Intergenic
1177639328 21:23826160-23826182 CATCGGAGGGACCCCGTGGGAGG + Intergenic
1177692449 21:24528975-24528997 CATGAGAGGGACCCAGTGGGAGG - Intergenic
1177736001 21:25091138-25091160 CATGAGAGGGACTAAGTGGGAGG + Intergenic
1178020251 21:28399828-28399850 CATGGGAGGGACCCTGTGGGAGG + Intergenic
1178118533 21:29443104-29443126 CATGGGAGGGACCCAGTGGGAGG + Intronic
1178429304 21:32505085-32505107 CATGGGAGGGACATGGTGGGAGG - Intronic
1178471280 21:32895181-32895203 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1178483169 21:32997715-32997737 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1178782737 21:35620807-35620829 CATGGGAGGGACCCAGTGGGAGG + Intronic
1178813968 21:35910400-35910422 CTTGGGAGGGAGCCTGTGGGAGG + Intronic
1178982844 21:37279410-37279432 CATGGGAGGGACCCGGTGGGAGG + Intergenic
1179008530 21:37535005-37535027 CAGGAGAGGGAGACCCAGAGAGG + Intergenic
1179136900 21:38687726-38687748 CATGGGAGGGACCCGGTGGGAGG - Intergenic
1179272096 21:39859524-39859546 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1179300555 21:40105393-40105415 CGTGGGAGGGACCCCGTGGGAGG + Intronic
1180013840 21:45070081-45070103 CAGAAGAGGGAGACGATGGGTGG - Intergenic
1180135367 21:45858789-45858811 CATGGGAGGGACTCAGTGGGAGG + Intronic
1180189699 21:46156793-46156815 CATGGGAGGGACCCGGTGGGAGG + Intergenic
1180238388 21:46480381-46480403 CATGGGAGGGACCCAGTGGGAGG - Intronic
1181088927 22:20458836-20458858 CCAGAGAGGGAGACCTTGAGTGG - Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182058500 22:27379886-27379908 CATTAGATGGGGACCGAGGGAGG + Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182799876 22:33023245-33023267 CATGGGAGGGACCCAGTGGGAGG + Intronic
1182813677 22:33138916-33138938 CATGGGAGGGACACAATGGGAGG + Intergenic
1182891828 22:33825660-33825682 CATGGGAGGGACACAGTGGGAGG - Intronic
1182968023 22:34541313-34541335 CATGAGAGGGACCCCATGGGAGG - Intergenic
1183002534 22:34873585-34873607 TATGAGAGGGATCCGGTGGGAGG - Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184338726 22:43873451-43873473 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1184386298 22:44177000-44177022 CATGAGAGGGACCTGGTGGGAGG - Intronic
1184888972 22:47368033-47368055 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1184960707 22:47926449-47926471 CATGGGAGGGACCCCGTGGGAGG - Intergenic
1185133345 22:49053190-49053212 CATGGGAGGGAGCCAGTGGGAGG - Intergenic
1185185204 22:49394942-49394964 CATGGGAGGGACCCTGTGGGAGG + Intergenic
1185359984 22:50400351-50400373 CCTGAGATGGAGTTCGTGGGTGG + Intronic
949192983 3:1271963-1271985 CATGGGAGGGACCCAGTGGGAGG + Intronic
949280611 3:2342542-2342564 CGTGGGAGGGAGCCGGTGGGAGG + Intronic
949370760 3:3332519-3332541 CATGGGAGGGACCCAGTGGGAGG - Intergenic
949475995 3:4446222-4446244 CATGGGAGGGACTCAGTGGGAGG + Intronic
949601923 3:5609300-5609322 CATGGGAGGGACCCAGTGGGAGG - Intergenic
949607859 3:5674180-5674202 CATGGGAGGGACCCTGTGGGAGG - Intergenic
949845086 3:8361741-8361763 TATGAGAGGGACCCCGTGGGAGG - Intergenic
949854627 3:8450147-8450169 CATGGGAGGGACTCAGTGGGAGG - Intergenic
951010241 3:17669058-17669080 CATGGGAGGGACCCAGTGGGAGG + Intronic
951068867 3:18301895-18301917 CATGAGAGGGAGCTGGTGGGAGG + Intronic
951177248 3:19616175-19616197 CATGGGAGGGAGCTGGTGGGAGG - Intergenic
951737550 3:25884580-25884602 CATGAGAGGGACCCAGTGGGAGG - Intergenic
952029233 3:29120694-29120716 CATGGGAGGGACACAGTGGGAGG + Intergenic
952208642 3:31206198-31206220 CATGGGAGGGACCCGGTGGGAGG - Intergenic
952401077 3:32964835-32964857 CATGGGAGGGACCCAGTGGGAGG + Intergenic
952620209 3:35329023-35329045 CATGGGAGGGACCCAGTGGGAGG - Intergenic
952831275 3:37567331-37567353 CATGGGAGGGACCCAGTGGGAGG - Intronic
953082636 3:39635025-39635047 CATAAGAGGGACCCAGTGGGAGG + Intergenic
953449915 3:42997417-42997439 CATGAGAGAGAGACAGAGAGAGG + Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
955014520 3:55057062-55057084 CATGGGAGGGACCCGGTGGGAGG + Intronic
955231381 3:57102012-57102034 CATGAGAGGGAGGCTGAGGCAGG + Intronic
955451784 3:59076336-59076358 CTTGAGAGGCTGACAGTGGGAGG - Intergenic
955518019 3:59747458-59747480 CATGGGAGGGACCCAGTGGGAGG - Intergenic
955548378 3:60056628-60056650 CATGACATGGAGACCGGTGGTGG - Intronic
955765402 3:62339359-62339381 CATGGGAGGGACCCAGTGGGAGG + Intergenic
955833481 3:63028996-63029018 CAAGAGAGGGACATAGTGGGAGG - Intergenic
955834972 3:63044741-63044763 CATGGGAGGGAACCAGTGGGAGG - Intergenic
955863059 3:63352912-63352934 CATGGGAGGGACCCGGTGGGAGG - Intronic
956033160 3:65061310-65061332 AATGAGAGGGAGGCTGTGGTTGG + Intergenic
956034203 3:65072913-65072935 CATGGGAGGGACCCAGTGGGAGG - Intergenic
956789146 3:72667453-72667475 CATGGGAGGGACATGGTGGGAGG + Intergenic
956946953 3:74234257-74234279 CATGAGAGGGACCTGGTGGGAGG - Intergenic
957113424 3:75994389-75994411 CATGGGAGGGACCCAGTGGGAGG + Intronic
957264310 3:77941981-77942003 CATGGGAGGGACCCAGTGGGAGG + Intergenic
957787921 3:84905310-84905332 CATGGGAGGGAGCCCGAGAGGGG + Intergenic
957909366 3:86602565-86602587 GATGGGAGGGACACAGTGGGAGG + Intergenic
957918574 3:86718184-86718206 CATGGGAGGGATCCAGTGGGAGG + Intergenic
958042731 3:88245516-88245538 CATGGGAGGGACCCAGTGGGAGG + Intergenic
958157190 3:89770624-89770646 CATGGGAGGGACCCAGTGGGAGG - Intergenic
958695417 3:97521619-97521641 CATGGGAGGGACCCAGTGGGAGG - Intronic
958857285 3:99400067-99400089 CATGGGAGGGACCCAGTGGGAGG - Intergenic
959017708 3:101154550-101154572 CATGGGAGGGACCCAGTGGGAGG + Intergenic
959306017 3:104666732-104666754 CATGGGAGGGACCCAGTGGGAGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959482648 3:106892171-106892193 CATGGGAGGGGCACAGTGGGAGG + Intergenic
959524439 3:107360846-107360868 CATGGGAGGGACCCAGTGGGAGG + Intergenic
959741994 3:109731133-109731155 CATGAGAGGGACACAGTGGGAGG - Intergenic
959818407 3:110703501-110703523 CATGGGAGGGACCCTGTGGGAGG - Intergenic
959846421 3:111039341-111039363 CATGGGAGGGACCCAGTGGGAGG - Intergenic
960071431 3:113435475-113435497 CATGGGAGGGACCCAGTGGGAGG - Intronic
960139492 3:114138555-114138577 CATGGGAGGGACCCAGTGGGAGG - Intronic
960224770 3:115156780-115156802 CATGGGAGGGACCCAGTGGGAGG + Intergenic
960454435 3:117853136-117853158 CATGGGAAGGACCCCGTGGGAGG - Intergenic
960499545 3:118419650-118419672 CATGAGAGGGAACCTGTGGGAGG - Intergenic
960689027 3:120324004-120324026 CATGGGAGGGACCCAGTGGGAGG - Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
960996717 3:123345096-123345118 CATGGGAGAGAGACAGAGGGAGG + Intronic
961480561 3:127176964-127176986 CATGGGAGGGACCCAGTGGGAGG - Intergenic
961639935 3:128358716-128358738 CAGGTGAGGGAGACCGCTGGGGG + Intronic
961943012 3:130656758-130656780 CACGAGAGGGAGTCCAAGGGGGG - Intronic
962047426 3:131775500-131775522 TATGGGAGGGACACAGTGGGAGG + Intronic
962076637 3:132088876-132088898 CATGAGAGTAAGAATGTGGGAGG - Intronic
962460845 3:135611446-135611468 CATGGGAGGCACACAGTGGGAGG + Intergenic
962689233 3:137877133-137877155 TATGGGAGGGACACAGTGGGAGG + Intergenic
962951833 3:140226942-140226964 CATGAGAGGGACCTGGTGGGAGG - Intronic
963019199 3:140856065-140856087 CATGGGAGGGACCCAGTGGGAGG + Intergenic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963627210 3:147688830-147688852 CATGGGAGGGACACTGTGGGAGG - Intergenic
963878148 3:150500111-150500133 CATGGGAGGGATCCAGTGGGAGG - Intergenic
963899477 3:150720365-150720387 CATGGGAGGGACACGGTGGGAGG - Intergenic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964090719 3:152873314-152873336 CATGGGAGGGACTCAGTGGGAGG - Intergenic
964753118 3:160070308-160070330 CATGAGAGGGAGACCCCAAGGGG - Intergenic
964793168 3:160471635-160471657 CATGGGAGGGACATTGTGGGAGG + Intronic
964879791 3:161410710-161410732 CCTCAGAGGGAGAGAGTGGGAGG + Intergenic
964972774 3:162581759-162581781 CATGAGAGGGACCCAGTGGGAGG + Intergenic
965024977 3:163290952-163290974 CATGAGAGGGACCCAGTTGGAGG - Intergenic
965028617 3:163334906-163334928 CATGGGAGAGATACAGTGGGAGG - Intergenic
965072823 3:163937737-163937759 CATGAGAGGGACCCAGAGGGAGG - Intergenic
965098534 3:164267878-164267900 CATGGGAGGGACCCAGTGGGAGG - Intergenic
965101825 3:164308855-164308877 CATGAGAGGGACCTGGTGGGAGG - Intergenic
965230000 3:166038327-166038349 CATGGGAGGGACCCAGTGGGAGG + Intergenic
965270593 3:166613079-166613101 CATGAGAGGGACCTGGTGGGAGG - Intergenic
965302009 3:167017489-167017511 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302033 3:167017576-167017598 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302043 3:167017607-167017629 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302051 3:167017632-167017654 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302109 3:167017849-167017871 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302119 3:167017880-167017902 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302127 3:167017905-167017927 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965721422 3:171666448-171666470 CATGGGAGGGACCCAGTGGGAGG - Intronic
966268775 3:178080184-178080206 CATGAAAAGGAGAAGGTGGGAGG - Intergenic
966314677 3:178632593-178632615 CATGGGAGGGACTCAGTGGGAGG - Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967055381 3:185825229-185825251 CTTGAGAGGGAGAGAGAGGGAGG - Intergenic
967251688 3:187546619-187546641 CATGAGAGGGAGAAGGTGTAGGG - Intergenic
967406046 3:189117599-189117621 CATGGGAGGGACCCCATGGGAGG + Intronic
967414000 3:189196632-189196654 CATGGGAGGGACCCAGTGGGAGG - Intronic
967607778 3:191468005-191468027 CATGGGAGGGACACAGTGGGAGG - Intergenic
967611058 3:191506633-191506655 CATGGGAGGGACCCGGTGGGAGG - Intergenic
967786871 3:193506655-193506677 CATGGGAGGGACCCAGTGGGGGG + Intronic
967908159 3:194519011-194519033 CATGAGAGGAACCCAGTGGGAGG + Intergenic
968228604 3:196991314-196991336 CATGGGAGGGACCCGGTGGGAGG - Intronic
968296094 3:197577578-197577600 CATTACAGGGAGGCCGGGGGAGG + Intergenic
968407598 4:354273-354295 CATGAGAGAGGGTCTGTGGGGGG - Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968852966 4:3095498-3095520 CATCAGAGGGAGACTGTGCGAGG + Intronic
968892729 4:3379791-3379813 CATGGGAGGGAGTCAGTGGGAGG - Intronic
969391878 4:6896864-6896886 CATGGGAGGGACCCGGTGGGAGG - Intergenic
969544927 4:7819697-7819719 CGGGAGAGGGAGAACGTGGTAGG + Intronic
969546082 4:7828935-7828957 CATGGGAGGGACCCAGTGGGAGG + Intronic
969908226 4:10417511-10417533 CATAAGAGGGATCCAGTGGGAGG - Intergenic
969948170 4:10806186-10806208 CATGAGAGGAACCCAGTGGGAGG - Intergenic
969948973 4:10814036-10814058 CATGGGAGGGACCCAGTGGGAGG - Intergenic
970001143 4:11367365-11367387 GATGAGAGGAAGACCTTGCGGGG + Intergenic
970104027 4:12559937-12559959 CATGGGAGGGAACCTGTGGGAGG + Intergenic
970217761 4:13777599-13777621 CATGGGAGGGACCCAGTGGGAGG - Intergenic
970233265 4:13932924-13932946 CATGGGAGGGACCCGGTGGGAGG - Intergenic
970238414 4:13982153-13982175 CTTGAGAGGGAGCCCTGGGGAGG - Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970424228 4:15931666-15931688 CATGAGAGGGACCCAGTGGGAGG - Intergenic
970553524 4:17208419-17208441 CATGGGAGGGACCCTGTGGGAGG + Intergenic
970649082 4:18157797-18157819 CATGGGAGGGACCCAGTGGGAGG + Intergenic
970668267 4:18363424-18363446 CATGGGAGGGACCCAGTGGGAGG + Intergenic
970670734 4:18394004-18394026 CATGGGAGGGACCCTGTGGGAGG + Intergenic
970739388 4:19216322-19216344 CATGGGAGGGACCCAGTGGGAGG + Intergenic
970742562 4:19255187-19255209 CATGAGAGGGACCTGGTGGGAGG + Intergenic
971008053 4:22397627-22397649 CATGGGAGGGACCCAGTGGGAGG + Intronic
971056838 4:22922692-22922714 CATGGGAGGGACCCAGTGGGAGG + Intergenic
971068194 4:23059103-23059125 CGTGAGAGGGACACAGTGGGAGG - Intergenic
971069842 4:23079347-23079369 CATGGGAGGGACCCAGTGGGAGG - Intergenic
971126404 4:23760139-23760161 CATGGGAGGGACCCTGTGGGAGG - Intronic
971546152 4:27890043-27890065 CATGGGAGGGACCCAGTGGGAGG + Intergenic
971546407 4:27891929-27891951 CATCAGAGGGACTCAGTGGGAGG + Intergenic
971593879 4:28502509-28502531 TATGAGAGGGACCCAGTGGGAGG - Intergenic
971608932 4:28696356-28696378 CATGGGAGGGACCCGGTGGGAGG + Intergenic
971984015 4:33795552-33795574 CATGGGAGGGACCCAGTGGGAGG - Intergenic
972017532 4:34264682-34264704 CATGGGAGGGAGTTCGTGAGAGG - Intergenic
972227990 4:37036398-37036420 CATGGGAGGGACCCAGTGGGAGG - Intergenic
972326467 4:38021280-38021302 CATGGGAGGGACCCAGTGGGAGG - Intronic
972640404 4:40920123-40920145 CATGGGAGGGACATGGTGGGAGG + Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
972678122 4:41279866-41279888 CATGGGAGGGACCCAGTGGGAGG - Intergenic
972896740 4:43631137-43631159 CATGGGAGGGACCCAGTGGGAGG + Intergenic
972939285 4:44177502-44177524 CATGGGAGGGACCCAGTGGGAGG + Intronic
972998821 4:44919140-44919162 CATGAGAGGGACCTGGTGGGAGG + Intergenic
973072825 4:45886247-45886269 CATGAGAGGGACCCGGTGGGAGG + Intergenic
973582349 4:52356898-52356920 CATGGGAGGGACCCAGTGGGAGG - Intergenic
973598164 4:52513633-52513655 CATGAGAGGGATCCAGTGGGAGG + Intergenic
973752177 4:54032289-54032311 CATCAGAGGGAGACCGTAGAGGG - Intronic
973849795 4:54949566-54949588 CATGGGAGGGACCCAGTGGGAGG + Intergenic
974179002 4:58360638-58360660 CATGGGAGGGAGACTGAGGTGGG - Intergenic
974231212 4:59116576-59116598 CATGAGAGGGACACAGTGGAAGG + Intergenic
974265107 4:59577087-59577109 CATGGGAGGGACCCAGTGGGAGG + Intergenic
974430468 4:61790968-61790990 CATGGGAGGGACCCAGTGGGAGG - Intronic
974587464 4:63897406-63897428 CATGGGAGGGACATGGTGGGAGG - Intergenic
974658399 4:64854994-64855016 TAGGAGATGGAGACTGTGGGAGG - Intergenic
974662447 4:64910106-64910128 CATGGGAGGGATCCAGTGGGAGG - Intergenic
974763522 4:66308870-66308892 CATGGGAGGGACGCAGTGGGAGG + Intergenic
974981996 4:68968190-68968212 CATGGGAGGAAGACAGTGGAAGG + Intergenic
975107643 4:70586580-70586602 CATGGGAGGGACCCAGTGGGAGG - Intergenic
975284869 4:72605976-72605998 CATGAGAGGGACCCAGTGGGAGG + Intergenic
975307464 4:72866172-72866194 CATGGGAGGGACCCAGTGGGAGG + Intergenic
975495225 4:75029396-75029418 CATGGGAGGGACCCAGTGGGAGG + Intronic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976190228 4:82480068-82480090 CATGGGAGGGACCCAGTGGGAGG - Intergenic
976277029 4:83288490-83288512 CATGGGAGGGACCCAGTGGGAGG + Intergenic
976312290 4:83623929-83623951 CATGGGAAGGACACAGTGGGAGG + Intergenic
976395626 4:84551971-84551993 CATGGGAGGGACGCGGTGGGAGG - Intergenic
976413776 4:84747623-84747645 CATGAGAGGGACACAGTGGAAGG + Intronic
976540709 4:86271858-86271880 CATGGGAGGGACCCAGTGGGAGG - Intronic
976545481 4:86330478-86330500 CATGGGAGGGACCCAGTGGGAGG + Intronic
976678259 4:87726461-87726483 CATGGGAGGGACCCGGTGGGAGG + Intergenic
976820565 4:89201888-89201910 CATGGGAGGGAACCAGTGGGAGG - Intergenic
977053554 4:92161524-92161546 CATGGGAGGGACACAGTGGGAGG - Intergenic
977171904 4:93772632-93772654 GAGGAGAGGGAGAAGGTGGGAGG - Exonic
977192025 4:94012906-94012928 CATGGGAGGGACCCAGTGGGAGG + Intergenic
977284130 4:95081004-95081026 CATGAGAGGGACCCAGTAGGAGG + Intronic
977360049 4:95991360-95991382 CATGGGAGGGACCCAGTGGGAGG - Intergenic
977433141 4:96957509-96957531 CATGGGAGGGACCCAGTGGGAGG + Intergenic
977582925 4:98744819-98744841 CATGGGAGGGACCCAGTGGGAGG + Intergenic
977702383 4:100035382-100035404 TATGAGAGGGACCCAGTGGGAGG - Intergenic
977702650 4:100037278-100037300 CATGAGAGGGACCCAATGGGAGG - Intergenic
978226094 4:106337329-106337351 CATGGGAGGGACCCGGTGGGAGG + Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978498427 4:109384459-109384481 CATGAGAGGGAGACTGAGTCAGG + Intergenic
978843604 4:113245642-113245664 CATGGGAGGGACCCAGTGGGAGG - Intronic
978904184 4:113986276-113986298 CATGGGAGGGACCCAGTGGGAGG + Intergenic
979104416 4:116665897-116665919 CATGGGAGGGACCCAGTGGGAGG - Intergenic
979139339 4:117152471-117152493 CATGGGAGGGACCCAGTGGGAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979356384 4:119711183-119711205 CATGGGAGGGACATGGTGGGAGG + Intergenic
979699890 4:123655930-123655952 CATGGGAGGGACCCAGTGGGAGG - Intergenic
979778340 4:124618191-124618213 CATGGGAGGGACCCAGTGGGAGG + Intergenic
979849361 4:125557044-125557066 CATGAGAGGTACCCGGTGGGAGG - Intergenic
979984532 4:127297088-127297110 CATGGGAGGGACCCAGTGGGAGG - Intergenic
980142786 4:128941139-128941161 CATGGGAGGGACCCAGTGGGAGG - Intronic
980525583 4:133988091-133988113 CATGGGAGGGACATTGTGGGAGG - Intergenic
980545932 4:134261232-134261254 CATGGGAGGGAGCCTGGGGGAGG - Intergenic
981030611 4:140121857-140121879 CATGGGAGGGACCCAGTGGGGGG + Intronic
981359483 4:143830448-143830470 CATGGGAGGGACCCAGTGGGAGG + Intergenic
981380008 4:144061467-144061489 CATGGGAGGGACCCAGTGGGAGG + Intergenic
981657457 4:147127942-147127964 CATGGGAGGGACCCAGTGGGAGG - Intergenic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982045394 4:151440226-151440248 CATGAGAGGGACCCAGTGGGAGG - Intronic
982331044 4:154182409-154182431 CATGGGAGGGACCCAGTGGGAGG + Intergenic
982496100 4:156093921-156093943 CATGGGAGGGACCCAGTGGGAGG - Intergenic
982723262 4:158881188-158881210 AGGGAGAGGGAGACCGTGGAGGG - Intronic
983006597 4:162492262-162492284 CATGAGAAGGACCCAGTGGGAGG + Intergenic
983138723 4:164121576-164121598 CATGGGAGGGAGCTGGTGGGAGG - Intronic
983164697 4:164460572-164460594 CATGAGAGGGACCCAGTGGGAGG + Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
983657659 4:170099354-170099376 CATGGGAGGGACAACATGGGAGG - Intergenic
983714060 4:170755329-170755351 CATGAGAGGGACCTGGTGGGAGG + Intergenic
983824992 4:172248665-172248687 CCTGAGAGGGATCCGGTGGGAGG + Intronic
983874560 4:172861653-172861675 CATGGGAGGGACCCAGTGGGAGG + Intronic
983889348 4:173014939-173014961 CATGGGAGGGACCCAGTGGGAGG + Intronic
983899384 4:173117510-173117532 CATGGGAAGGACACAGTGGGAGG + Intergenic
983970105 4:173861152-173861174 CATGGGAGGAACACAGTGGGAGG - Intergenic
984286440 4:177735699-177735721 CATGAGAGGGACCTGGTGGGAGG + Intronic
984320148 4:178185332-178185354 CATGAGAAAGACCCCGTGGGAGG - Intergenic
984419073 4:179496615-179496637 CATGGGAGGGACCCAGTGGGAGG - Intergenic
984571319 4:181397671-181397693 CATGGGAGGGACCCAGTGGGAGG - Intergenic
984718912 4:182952281-182952303 CAATAGAGGGAGAGCGTGGCAGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984804410 4:183737780-183737802 AGGGAGAGGGAGACCGTGGAGGG + Intergenic
985022566 4:185707870-185707892 CATGGGAGGGATCCGGTGGGAGG - Intronic
985337577 4:188913289-188913311 CATGGGAGGGACCCAGTGGGAGG - Intergenic
985362962 4:189194731-189194753 CATGGGAGGGACCCAGTGGGAGG + Intergenic
985535883 5:465537-465559 GGTGAGGGCGAGACCGTGGGAGG - Intronic
985802035 5:2010812-2010834 CATCAGCGGGAGACCCAGGGAGG - Intergenic
986081881 5:4403310-4403332 CATGGGAGGGACACAGTGAGAGG - Intergenic
986194763 5:5527642-5527664 CATGGGAGGGACCCAGTGGGAGG + Intergenic
986201195 5:5580307-5580329 CGTGGGAGGGACGCCGTGGGAGG + Intergenic
986220364 5:5763477-5763499 CATGGGAGGGACCCAGTGGGAGG + Intergenic
986253451 5:6082052-6082074 CATGGGAGGGACCCAGTGGGAGG + Intergenic
986289839 5:6390903-6390925 CATGAGAGGGACTCGGTGGGAGG + Intergenic
986477957 5:8154707-8154729 CATGGGAGGGACCCGGTGGGAGG + Intergenic
986792003 5:11171018-11171040 CATGGGAGGGACCCCATGGGAGG - Intronic
986797548 5:11226696-11226718 CATGGGAGGGACCCAGTGGGAGG - Intronic
986861305 5:11929339-11929361 CATGGGAGGGACCCAGTGGGAGG + Intergenic
986894216 5:12346353-12346375 CATGGGAGGGACCCAGTGGGAGG + Intergenic
986910035 5:12544444-12544466 CATGGGAGGGACCCAGTGGGAGG - Intergenic
987102049 5:14600101-14600123 CATGGGAGGGACCCAGTGGGAGG + Intronic
987230341 5:15887328-15887350 ACTGAGAGGGAGAACGAGGGAGG + Intronic
987386717 5:17337031-17337053 CATGAGAGGAACCCAGTGGGAGG - Intergenic
987465304 5:18265110-18265132 CATGGGAGGGACCCAGTGGGAGG + Intergenic
987605716 5:20133444-20133466 CATGGGAGGGATCCAGTGGGAGG - Intronic
987851710 5:23363135-23363157 CATGGGAGGGACACAGTGAGAGG - Intergenic
987916277 5:24218770-24218792 CATGGGAGGGACCCGGTGGGAGG + Intergenic
987924575 5:24323773-24323795 CATGGGAGGGACCCAGTGGGAGG + Intergenic
988142849 5:27265468-27265490 CATGGGAGGGACCCAGTGGGAGG + Intergenic
988356849 5:30187675-30187697 CATGGGAGGGACACAGTGGAAGG + Intergenic
988362531 5:30254796-30254818 CATGGGAGGGAGCCAGTGGGAGG - Intergenic
988362775 5:30256694-30256716 CATGGGAGGGACCCGGTGGGAGG - Intergenic
988410888 5:30884538-30884560 CATGGGAGGGACCCAGTGGGAGG + Intergenic
988474020 5:31566782-31566804 CATGGGAGGGACCCAGTGGGAGG - Intergenic
988484909 5:31660660-31660682 CATGGGAGGGACTCAGTGGGAGG - Intronic
988685234 5:33519237-33519259 CATGAGAGGGACTCAGTGGGAGG + Intergenic
988804625 5:34728447-34728469 CATGGGAGGGACCCAGTGGGAGG + Intronic
988861922 5:35290399-35290421 CATGGGAGGGACCCAGTGGGAGG + Intergenic
988870144 5:35380415-35380437 CATGGGAGGGACCCAGTGGGAGG + Intergenic
988911401 5:35847173-35847195 CATGGGAGGGACCCAGTGGGAGG - Intergenic
988953959 5:36295269-36295291 CATGGGAGGGACCCAGTGGGAGG + Intronic
988958244 5:36341167-36341189 CATGGGAGGGACCCAGTGGGAGG + Intergenic
989140187 5:38194273-38194295 CAGGAGAGGGAGACAGAGAGAGG + Intergenic
989151813 5:38307322-38307344 CATGGGAGGGACCCAGTGGGAGG + Intronic
989297722 5:39849439-39849461 CATGGGAGGGACCCGGTGGGAGG - Intergenic
989515120 5:42334149-42334171 CATGAGAGGAACCCAGTGGGAGG + Intergenic
989545342 5:42665981-42666003 CATGAGAGGGAGCTGGTGGAAGG - Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
989787209 5:45346173-45346195 CATGGGAGGGACCCCGTGGGAGG - Intronic
989966730 5:50473985-50474007 CATGGGAGGGACCCAGTGGGAGG + Intergenic
990146014 5:52761086-52761108 CAAGAGAGGGACCCAGTGGGAGG + Intergenic
990202111 5:53387414-53387436 CATGGGAGGGACCCGGTGGGAGG - Intergenic
990235053 5:53758354-53758376 CATGAGAGAGAGAGGCTGGGGGG - Intergenic
990861157 5:60329210-60329232 CATGAGAGGGACCCAGTAGGAGG + Intronic
991119301 5:62993393-62993415 CATGGGAGGAACACAGTGGGAGG - Intergenic
991202516 5:64010621-64010643 CATGGGAGGGACCCAGTGGGAGG + Intergenic
991207011 5:64060669-64060691 CATGGGAGGGACCCAGTGGGAGG + Intergenic
991261061 5:64668844-64668866 CATGGGAGGGACCCAGTGGGAGG + Intergenic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991405159 5:66294159-66294181 CTTGAGCGGGAGCCCGTGGAAGG - Intergenic
991409239 5:66330431-66330453 CATGGGAGGGACCCAGTGGGAGG + Intergenic
991409524 5:66332341-66332363 CATGGGAGGGACCCAGTGGGAGG + Intergenic
992018392 5:72598472-72598494 CATGGGAGGGACCCCATGGGAGG - Intergenic
992219028 5:74553805-74553827 CATGGGAGGGATCCGGTGGGAGG - Intergenic
992527647 5:77628322-77628344 CGTGATGGGGAGGCCGTGGGTGG - Intergenic
992977839 5:82138876-82138898 CATGAGAGGGAGAGGGAGAGGGG - Intronic
993015771 5:82532969-82532991 CATGGGAGGGACCCAGTGGGAGG - Intergenic
993024013 5:82625647-82625669 CATGGGAGGGACCCAGTGGGAGG + Intergenic
993198659 5:84783216-84783238 CATGAAAGAGAGAGAGTGGGGGG + Intergenic
993200670 5:84811792-84811814 CATGGGAGGGACTCAGTGGGAGG + Intergenic
993451405 5:88075221-88075243 CATGGGAGGGACCCAGTGGGAGG + Intergenic
993703390 5:91143867-91143889 CATGGGAGGGAGGCTGAGGGGGG - Intronic
993967337 5:94373667-94373689 CATGAGAGGGACCCAGTGGGAGG - Intronic
994057367 5:95433412-95433434 CATGAGAAGGACCCCGTGGGAGG - Intronic
994081947 5:95716783-95716805 CATGAGAGGGACCCAGTGGGAGG + Intronic
994166118 5:96610036-96610058 CCTGGGAGGGACACAGTGGGAGG + Intronic
994398184 5:99245185-99245207 CATGGGAGGGACCCAGTGGGAGG - Intergenic
994753266 5:103764514-103764536 CATGAGAGGGAGGCTGAGAGAGG - Intergenic
994760362 5:103844314-103844336 CATGAGAGAGATCCAGTGGGAGG - Intergenic
994762685 5:103876621-103876643 CATGGGAGGGACCCGGTGGGAGG - Intergenic
995120460 5:108531025-108531047 CATGGGAGGGACCCGGTGGGTGG - Intergenic
995212327 5:109554200-109554222 CATGGGAGGGATGCAGTGGGAGG - Intergenic
995262571 5:110122665-110122687 CATGGGAGGGATATAGTGGGAGG + Intergenic
995283316 5:110358770-110358792 CATGAGAGGGACCCAGTGGGAGG + Intronic
995390828 5:111638921-111638943 CATGGGAGGGACCCAGTGGGAGG + Intergenic
995443649 5:112219211-112219233 CGTGGGAGGGAGCCAGTGGGAGG + Intronic
995921947 5:117325149-117325171 TATGAGAGGGACCCAGTGGGAGG - Intergenic
996006737 5:118429995-118430017 CATGGGAGGGATCCAGTGGGAGG - Intergenic
996042163 5:118827413-118827435 CATGAGAGGGACCTGGTGGGAGG - Intergenic
996179419 5:120400427-120400449 CATGGGAGGGAACCTGTGGGAGG + Intergenic
996250917 5:121331006-121331028 CATGAGAGAGACACAGTGGGAGG + Intergenic
996333098 5:122353548-122353570 CATGGGAGGGACCCAGTGGGAGG + Intronic
996699901 5:126439790-126439812 CATGGGAGGGAGCCAGTGGGAGG + Intronic
996774627 5:127120387-127120409 CATGAGAGGGACCCATTGGGAGG - Intergenic
996788951 5:127271591-127271613 CATGGGAGGGACCCAGTGGGTGG + Intergenic
996922682 5:128787360-128787382 CATGAGAGGGAACTGGTGGGAGG - Intronic
996967440 5:129322354-129322376 CATGGGAGGGAGCCAGTGGGAGG - Intergenic
997109206 5:131056285-131056307 CATGGGAGGGACTCAGTGGGAGG - Intergenic
997148603 5:131466508-131466530 CATGGGAGGGAGCCAGTGGGAGG + Intronic
997300795 5:132802806-132802828 CATGGGAGGCACCCCGTGGGAGG + Intronic
997321806 5:132983928-132983950 AGGGAGAGGGAGACCGTGGGGGG + Intergenic
997343062 5:133161692-133161714 CATGAGAAGGAGGCAGAGGGAGG + Intergenic
997879492 5:137576711-137576733 CATGGGAGGGACCCAGTGGGAGG - Intronic
998756418 5:145385966-145385988 CAAGGGAGGGACAACGTGGGAGG + Intergenic
999251392 5:150184294-150184316 ATTGAGAGGGAGGCCCTGGGAGG + Exonic
999436783 5:151569444-151569466 CATGGGAGGGATCCAGTGGGAGG - Intergenic
999541208 5:152573947-152573969 CATGGGAGGGACCCGGTGGGAGG + Intergenic
999610892 5:153368424-153368446 CATGGGAGGGACCCAGTGGGAGG - Intergenic
999864254 5:155683846-155683868 CATGGGAGGGACCCAGTGGGTGG + Intergenic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1000498127 5:162011561-162011583 CATGAGAGGGACCCAGTGGGAGG - Intergenic
1000580532 5:163030558-163030580 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1000637924 5:163664704-163664726 CATGGGAGGGACCCGGTGGGAGG + Intergenic
1000659626 5:163921171-163921193 CATGGGAGGGAGCCCATGGTTGG + Intergenic
1000691031 5:164320955-164320977 CATGGGAGGGAGCCAGTGGGAGG - Intergenic
1000996353 5:167962818-167962840 CATGGGAGGGACCCAGTGGGAGG - Intronic
1001008495 5:168075968-168075990 CGTGGGAGGGAGACGGTGGGAGG - Intronic
1001938670 5:175725875-175725897 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1002550703 5:179989250-179989272 CATGTGAGGGACCCAGTGGGAGG - Intronic
1002600623 5:180352543-180352565 CACGAGAGGGAGTCCGGGGCGGG - Intronic
1003291680 6:4784793-4784815 CATGGGAGGGACCCTGTGGGAGG + Intronic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1003494144 6:6649262-6649284 CATGGGAGGGACCCAGTGGGAGG - Intronic
1003849472 6:10206909-10206931 CATGGGAGGGACCCGGTGGGAGG + Intronic
1004181264 6:13382313-13382335 CATGGGAGGGACCCAGTGGGAGG + Intronic
1004455585 6:15788611-15788633 CATGAAAGGGACCCAGTGGGAGG + Intergenic
1004700571 6:18075573-18075595 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1004815049 6:19303712-19303734 CATGAGAGGCAGATCCTGTGAGG - Intergenic
1005138702 6:22601432-22601454 CATGGGAGGGACCCGGTGGGAGG + Intergenic
1005149628 6:22734011-22734033 CATGGGAGGGACCCGGTGGGAGG + Intergenic
1005331468 6:24754717-24754739 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1005982800 6:30850287-30850309 CATGAGAGGGACCTGGTGGGAGG + Intergenic
1007243682 6:40444797-40444819 ACTGAGAGGGAGACTGTGCGGGG - Intronic
1008134283 6:47756075-47756097 TATGGGAGGGACACAGTGGGAGG + Intergenic
1008279501 6:49579110-49579132 CGTGAGAGGGACTCAGTGGGAGG + Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008966954 6:57322423-57322445 CATGGGAGGGACCCGGTGGGAGG + Intronic
1009243410 6:61205162-61205184 CATGGGAGGGAGACTGAGGGGGG - Intergenic
1009501686 6:64421335-64421357 CATGGGAGGGAGCCAGTAGGAGG - Intronic
1009584858 6:65587355-65587377 CGTGAGAGGGACCCCATGGGAGG + Intronic
1009729194 6:67578142-67578164 TATGGGAGGGAGCCAGTGGGAGG + Intergenic
1009847509 6:69151845-69151867 CATGGGAGGGACCCAGTGGGAGG + Intronic
1010127321 6:72448211-72448233 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1010279108 6:74003386-74003408 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1010549379 6:77201975-77201997 CATGAGAGGAACCCAGTGGGAGG + Intergenic
1010810288 6:80292507-80292529 CATGGGAGGGACCCGGTGGGAGG - Intronic
1010819283 6:80394830-80394852 CATGAGAGGGACCCAGTGGGAGG + Intergenic
1010864150 6:80952735-80952757 CATGAGAGGGACCCAGTGGGAGG - Intergenic
1011003901 6:82622519-82622541 CATGGGAGGGAGCCAGTGGGAGG - Intergenic
1011026147 6:82871724-82871746 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1011040937 6:83030296-83030318 CATGGGAGGGACCCAGTGGGAGG + Intronic
1011210897 6:84955631-84955653 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1011222922 6:85076253-85076275 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1011347551 6:86388745-86388767 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1012192432 6:96297051-96297073 CAGAAGAGGGAGACTGTGAGGGG + Intergenic
1012390152 6:98729114-98729136 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1012825131 6:104138457-104138479 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1012832941 6:104228637-104228659 CATGGGAGGGAGCTGGTGGGAGG + Intergenic
1013338526 6:109190569-109190591 CATGAGAGGGACTCGGTGGGAGG + Intergenic
1013338800 6:109192542-109192564 CATGGGAGGGACACAGTGGGAGG + Intergenic
1013496681 6:110704818-110704840 AATGAGAGGGAGATGGAGGGAGG + Intronic
1013530951 6:111018185-111018207 CATCAGGGGGAGACCGGGGAGGG + Intronic
1013558627 6:111282872-111282894 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1013675993 6:112463793-112463815 CATGAGAGGGACCCAGTGGAAGG + Intergenic
1013769354 6:113610158-113610180 CATGAGAGGGACTCGGTGGGAGG + Intergenic
1013806359 6:114000183-114000205 CATGGGAGGGACCCGGTGGGAGG - Intronic
1014134125 6:117867746-117867768 CATGAGAGGGACCCAGTGGGAGG - Intergenic
1014143758 6:117972735-117972757 CATGGGAGGGACCCAGTGGGAGG - Intronic
1014187172 6:118448053-118448075 CATGGGAGGGACAGGGTGGGAGG - Intergenic
1014580936 6:123136752-123136774 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1014619432 6:123647437-123647459 CATGGGAGGGAGCCAGTGGGAGG - Intergenic
1014648244 6:124003020-124003042 AATGAAAGGGATGCCGTGGGAGG - Intronic
1014742280 6:125159904-125159926 CATGGGAGGGAGCCATTGGGAGG + Intronic
1015039978 6:128704499-128704521 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1015172734 6:130271942-130271964 CATGGGAGGGACCCAGTGGGAGG - Intronic
1015173359 6:130279258-130279280 CATGAGAGGGTCCCAGTGGGAGG + Intronic
1015196368 6:130528487-130528509 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1015476310 6:133662093-133662115 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1015694556 6:135965701-135965723 CATGGGAGGGACCCAGTGGGAGG - Intronic
1015852879 6:137592833-137592855 CATGAGAGGGACCTGGTGGGAGG - Intergenic
1016077619 6:139816107-139816129 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1016151626 6:140748269-140748291 CATGATAGGGACCCAGTGGGAGG + Intergenic
1016168589 6:140978948-140978970 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1016385170 6:143523827-143523849 CATGGGAGAGAGCCGGTGGGAGG + Intergenic
1016439648 6:144069779-144069801 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1016501440 6:144725095-144725117 CATGGGAGGGACCCAGTGGGAGG + Intronic
1016587839 6:145709349-145709371 CATGGGAGGGACCCAGTGGGAGG + Intronic
1016702692 6:147071084-147071106 CATGGGAGGGACCCTGTGGGAGG - Intergenic
1016786556 6:148016852-148016874 CATGAGAGGGACCTGGTGGGAGG - Intergenic
1017225252 6:152013963-152013985 CATGGGAGGGACCCGGTGGGAGG + Intronic
1017277371 6:152585017-152585039 CATGAGAGGGACCCGGTGGGAGG + Intronic
1017524394 6:155229973-155229995 CATGGGAGGGACCCAGTGGGAGG - Intronic
1017763554 6:157589470-157589492 CATGGGAGGGACCCAGTGGGAGG + Intronic
1017763834 6:157591342-157591364 CATGGGAGGGACCCAGTGGGAGG + Intronic
1017790525 6:157794116-157794138 CATGGGAGGGACCCAGTGGGAGG + Intronic
1018245087 6:161814895-161814917 CATGGGAGGGACCCTGTGGGAGG - Intronic
1018447850 6:163874655-163874677 CATGGGAGGGAGCTGGTGGGAGG - Intergenic
1018549614 6:164980683-164980705 CATGGGAGGGACACAGAGGGAGG + Intergenic
1018658474 6:166063404-166063426 CAAGTGAGAGAGACAGTGGGGGG - Intergenic
1018734090 6:166674510-166674532 CTTTAGAGGGAGACCGGGTGAGG + Intronic
1019158894 6:170056630-170056652 GATGAGGGGGAGACCCGGGGCGG - Intergenic
1019394096 7:807500-807522 CATGGGAGGGACCCGGTGGGAGG + Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019550264 7:1598935-1598957 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1020581904 7:10012569-10012591 CATGGGAGGGACTCAGTGGGAGG + Intergenic
1020729807 7:11866846-11866868 CATGGGAGGGACCCGGTGGGAGG + Intergenic
1021058508 7:16080554-16080576 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1021136805 7:16974843-16974865 CATGGGAGGGACACCGTGGGAGG - Intergenic
1021377938 7:19931947-19931969 CATGAGAGGGACCGAGTGGGAGG - Intergenic
1021400803 7:20207918-20207940 CATGGGAGGGACCCTGTGGGAGG + Intronic
1021467934 7:20967207-20967229 AATGAGAGTGAGAGGGTGGGGGG + Intergenic
1021480061 7:21105764-21105786 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1021570416 7:22059370-22059392 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1021842043 7:24728698-24728720 CCTGCGGGGGAGACAGTGGGCGG - Intronic
1021901639 7:25291306-25291328 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1022092094 7:27114192-27114214 CAGGAGAGGGAGGGCGTTGGGGG - Intronic
1022205463 7:28159424-28159446 CAGGAGAGGAGGACCGTGAGTGG + Intronic
1022689720 7:32636926-32636948 CATTAGAGGGAGGTGGTGGGTGG - Intergenic
1022776478 7:33532624-33532646 CATGGGAGGGACCCAGTGGGAGG - Intronic
1022917289 7:34971105-34971127 CATTAGAGGGAGGTGGTGGGTGG - Intronic
1023201657 7:37704554-37704576 CATGGGAGGGACTCAGTGGGAGG - Intronic
1023291001 7:38668998-38669020 CATGGGAGGGACCCGGTGGGAGG + Intergenic
1023495444 7:40790157-40790179 CATGGGAGGGACCCAGTGGGAGG + Intronic
1023901058 7:44479146-44479168 CATGGGAGGGACCCGGTGGGAGG - Intronic
1024347434 7:48327368-48327390 CATGAGAGGAACATGGTGGGAGG - Intronic
1024384615 7:48737638-48737660 CATGGGAGGGACCCCATGGGAGG + Intergenic
1024439926 7:49405390-49405412 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1024826922 7:53401114-53401136 CATGAGAGGGACTCGGTGGAAGG - Intergenic
1025042306 7:55657828-55657850 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026051430 7:66950301-66950323 CATGGGAGGGACCCAGTGGGAGG + Intronic
1026349023 7:69499544-69499566 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1026502453 7:70954502-70954524 CATGGGAGTGACACCGTGGGAGG + Intergenic
1026540925 7:71279385-71279407 CATGGGAGGGACCCAGTGGGAGG - Intronic
1026631480 7:72041726-72041748 CATGGGAGGGACCCAGTGGGAGG + Intronic
1026653771 7:72238573-72238595 CATGGGAGGGACCCAGTGGGAGG + Intronic
1027673704 7:81133349-81133371 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1028081067 7:86577101-86577123 CATGGGAGGGACTCAGTGGGAGG + Intergenic
1028191885 7:87863273-87863295 CATGAGAGGGACCCAGTGAGAGG + Intronic
1028291737 7:89074359-89074381 CATGAGAGGAACCCAGTGGGAGG + Intronic
1028844727 7:95466919-95466941 CATGGGAGGGACCCGGTGGGAGG - Intergenic
1029593246 7:101521234-101521256 CAAGGGAGGGACACGGTGGGAGG - Intronic
1030379623 7:108797533-108797555 CAAGAGAGGGACCCTGTGGGAGG - Intergenic
1030510775 7:110480206-110480228 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1030555770 7:111021964-111021986 CATGGGAGGGACCCAGTGGGAGG - Intronic
1030619913 7:111777690-111777712 CATGGGAGGGACAAGGTGGGAGG + Intronic
1030841610 7:114360058-114360080 CATGGGAGGGATGCGGTGGGAGG + Intronic
1031064997 7:117095228-117095250 CATGAGAGCCAGAACGTGGCTGG + Intronic
1031200860 7:118683426-118683448 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1031396789 7:121284265-121284287 TATGAGAGGGACCTCGTGGGAGG - Intronic
1031645449 7:124220486-124220508 CATGAGAGGGACCCAGTGGAAGG + Intergenic
1031654228 7:124332412-124332434 CATGAGAGGGACTCGGTGGGAGG + Intergenic
1031720163 7:125164657-125164679 CATGCGAGGGAGATCATGGCAGG + Intergenic
1031772768 7:125865959-125865981 CATGAGAGGGACCCTGTGGGAGG + Intergenic
1031788441 7:126065960-126065982 CATGGGAGGGACCCCGTGGGAGG - Intergenic
1031818410 7:126469497-126469519 CATGGGAGGGACTCAGTGGGAGG + Intronic
1032311504 7:130791498-130791520 CATGGGAGGGATCCAGTGGGAGG - Intergenic
1032347941 7:131134266-131134288 CATGAGAGTGGGACAGAGGGAGG - Intronic
1032513114 7:132487717-132487739 CATGAGAGGAAGACCCGGGAAGG + Intronic
1032534686 7:132652945-132652967 CATGGGAGGGACCCAGTGGGAGG + Intronic
1032732395 7:134656700-134656722 CATGGGAGGGACCCAGTGGGAGG - Intronic
1032799680 7:135307967-135307989 CAAGGGAGGGACCCCGTGGGAGG + Intergenic
1033057845 7:138076097-138076119 CATGGGAGGGACTCAGTGGGAGG - Intronic
1033112551 7:138594356-138594378 TGTGAGAGGGAGATGGTGGGGGG - Intronic
1033256313 7:139804617-139804639 CATGGGAGGGACACAGTGGGAGG + Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033410286 7:141111326-141111348 CATGGGAGGGACCCAGTGGGAGG - Intronic
1033634047 7:143192305-143192327 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1033792475 7:144807403-144807425 CATGGGAGGGACACAGTGGGAGG - Intronic
1033932953 7:146546870-146546892 CATGGGAGGGACCCAGTGGGAGG - Intronic
1034075200 7:148224947-148224969 CATGGGAGGGACCCAGTGGGAGG - Intronic
1034298013 7:149991250-149991272 CCTGGGAGGGACACAGTGGGAGG - Intergenic
1034420247 7:150986782-150986804 CAGGAGAGGGAGACAGGAGGAGG + Intergenic
1034516904 7:151588273-151588295 CATGGGAGGGACCCAGTGGGAGG + Intronic
1034683710 7:152951208-152951230 CATGGGAGGGACCCTGTGGGAGG + Intergenic
1034808009 7:154105603-154105625 CCTGGGAGGGACACAGTGGGAGG + Intronic
1034847291 7:154458194-154458216 CATGGGAGGGACCCAGTGGGAGG + Intronic
1034926682 7:155128324-155128346 CATGAGAGGGACCTGGTGGGAGG + Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035048936 7:155987225-155987247 CATGGGAGGGACCCGGTGGGAGG + Intergenic
1035092390 7:156324724-156324746 AAGGAGAGGGAGAGAGTGGGAGG + Intergenic
1035102118 7:156408304-156408326 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1035149774 7:156860410-156860432 CATGGGAGGGACCCAGTGGGAGG - Intronic
1035177108 7:157059249-157059271 CATGGGAGGGATCCAGTGGGAGG + Intergenic
1035345903 7:158197844-158197866 CATGGGAGGGACCCAGTGGGAGG - Intronic
1035597946 8:875376-875398 CATGAGAGGGACCCGGTGAGAGG + Intergenic
1035651009 8:1264820-1264842 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1035691168 8:1561014-1561036 CATGAGAGGGACCCAGTAGGAGG + Intronic
1035884391 8:3276565-3276587 CATGGGAGGGACCCAGTGGGAGG - Intronic
1036095408 8:5718793-5718815 CATGGGAGGGACACAGTGGGAGG - Intergenic
1036129686 8:6097584-6097606 GAGGAGAGAGAGACCGAGGGGGG + Intergenic
1036384362 8:8265751-8265773 CATGGGAGGGACATGGTGGGAGG - Intergenic
1036434457 8:8720525-8720547 CATGAGAGGGACCCTGTGGGAGG + Intergenic
1036571374 8:9982531-9982553 CATGAGAGGGACCTGGTGGGAGG + Intergenic
1036705342 8:11042351-11042373 CATGGGAGGGACCCGGTGGGAGG + Intronic
1036990777 8:13591303-13591325 CATGGGAGGGACGCAGTGGGAGG + Intergenic
1037036018 8:14168415-14168437 CATGGGAGGGACCCAGTGGGAGG + Intronic
1037155627 8:15695229-15695251 CATGGGAGGGACCCAGTGGGAGG + Intronic
1037158196 8:15732256-15732278 CATGGGAGGGATCCAGTGGGAGG + Intronic
1037263552 8:17034974-17034996 CATGAGAGGGACCCAGTGGGAGG + Intronic
1037291142 8:17350519-17350541 CATGGGAGGGACCCGGTGGGAGG - Intronic
1037310194 8:17547371-17547393 CATGGGAGGGACCCAGTGGGAGG - Intronic
1037476012 8:19258389-19258411 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1037679888 8:21088459-21088481 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1038289850 8:26239321-26239343 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1038572262 8:28672864-28672886 CATGGGAGGGACCCGGTGGGAGG + Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1038745648 8:30252572-30252594 CATGAGAGGGAGGCCCTTGCTGG + Intergenic
1038851968 8:31287791-31287813 CATGGGAGGGATCCAGTGGGAGG - Intergenic
1038958684 8:32495196-32495218 CATGGGAGGGATCCCGTCGGAGG + Intronic
1039029442 8:33293782-33293804 CATAAGAGGGACATGGTGGGAGG - Intergenic
1039073478 8:33667299-33667321 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1039107285 8:34003477-34003499 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1039107544 8:34005435-34005457 CGTGAGAGGGACTCAGTGGGAGG - Intergenic
1039282826 8:36005634-36005656 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1039305965 8:36263351-36263373 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1039363347 8:36903959-36903981 CATGGGAGGGACCCAGTGGGAGG - Intronic
1039427543 8:37498512-37498534 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1039491280 8:37949323-37949345 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1039526888 8:38225088-38225110 CATGAGAGGGACTCGGTGGGAGG + Intergenic
1039684276 8:39780259-39780281 CATGGGAGGGACCCGGTGGGAGG - Intronic
1039703727 8:39986777-39986799 CAGGAGAGGGATCCAGTGGGAGG + Intronic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040677420 8:49766891-49766913 CAAGAGAGAGAGAATGTGGGTGG - Intergenic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1040835842 8:51730923-51730945 CATGGGAGGGACTCAGTGGGAGG - Intronic
1041042318 8:53859908-53859930 CATGGGAGGGACCCGGTGGGAGG - Intronic
1041316397 8:56567624-56567646 CATGGGAGGGACCCTGTGGGAGG + Intergenic
1041894589 8:62908526-62908548 CATGGGAGGGACCCAGTGGGAGG + Intronic
1042029928 8:64464828-64464850 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1042032769 8:64494754-64494776 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1042193452 8:66211506-66211528 CATGGGAGGGAGCCGGTGGGAGG - Intergenic
1042298069 8:67243516-67243538 CATGAGAGAGACCCAGTGGGAGG - Intronic
1042485282 8:69340197-69340219 CGTGGGAGGGAGCCGGTGGGAGG + Intergenic
1042489893 8:69385196-69385218 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1042608974 8:70577169-70577191 CACGAGAGGGAGGCCGAGGGGGG + Intronic
1042826217 8:72982579-72982601 CATGAGAGGGCCCCAGTGGGAGG + Intergenic
1042969650 8:74394284-74394306 CATGGGAGGGACCCAGTGGGAGG - Intronic
1043004549 8:74802489-74802511 CATGAAAGGGACCCAGTGGGAGG + Intronic
1043030673 8:75130447-75130469 CATGGGAGGGACCCGGTGGGAGG + Intergenic
1043062335 8:75519652-75519674 CATGACAGGGACCCAGTGGGAGG - Intronic
1043073979 8:75672995-75673017 CGTGAGAGGGACCCGGTGGGAGG + Intergenic
1043077233 8:75717457-75717479 CATGGGAGGGACTCAGTGGGAGG - Intergenic
1043109280 8:76158010-76158032 TATGGGAGGGACACAGTGGGAGG + Intergenic
1043275147 8:78383998-78384020 CATGAGAGGGACCCAATGGGAGG + Intergenic
1043275402 8:78385960-78385982 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1043385840 8:79747277-79747299 CATGGGAGGGACCCTGTGGGAGG - Intergenic
1043393586 8:79814571-79814593 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1043663432 8:82776568-82776590 CATTGGAGGGACACAGTGGGAGG + Intergenic
1043678434 8:82991435-82991457 CTTGAGAGGGAGATTCTGGGTGG + Intergenic
1043798695 8:84579125-84579147 CATGGGAGGGAGGCCTAGGGGGG - Intronic
1043801054 8:84610028-84610050 CATGAGAGGGATCCAGTGGGAGG - Intronic
1043818162 8:84829250-84829272 CATGGTAGGGAGCCAGTGGGAGG - Intronic
1044070636 8:87755842-87755864 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1044103797 8:88175767-88175789 CCTGGGAGGGACTCCGTGGGAGG + Intronic
1044504296 8:93000513-93000535 CATGGGAGGGAAATGGTGGGAGG - Intronic
1044524236 8:93233287-93233309 CATGGGAGGGACGCAGTGGGAGG + Intergenic
1044534115 8:93339927-93339949 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1044774998 8:95678398-95678420 CATGGGAGTGAGGCCGAGGGGGG - Intergenic
1044919271 8:97150463-97150485 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1044945726 8:97387116-97387138 CATGTGAGAGAGACAGTGGTAGG + Intergenic
1044965578 8:97570772-97570794 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045199139 8:99961357-99961379 CATGGGAGGGACCCAGTGGGAGG + Intronic
1045567730 8:103338595-103338617 CATGGGAGGGACACACTGGGAGG - Intergenic
1045894767 8:107202080-107202102 CATGGGAGGGATGCAGTGGGAGG - Intergenic
1046046268 8:108968586-108968608 CATGAGAGGAACCCAGTGGGAGG + Intergenic
1046103952 8:109644899-109644921 CAGGTGAGGGAGGGCGTGGGAGG - Intronic
1046146697 8:110170733-110170755 CATGAGAGGGATCCAGTAGGAGG + Intergenic
1046391341 8:113576840-113576862 CATGAGAGGGACCCTGTGGGAGG + Intergenic
1046517478 8:115282103-115282125 CATGAGAGGGACCCGGTGAGAGG - Intergenic
1046552254 8:115731643-115731665 CATGAGAGGGACCCAGTGGGAGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046668980 8:117036730-117036752 CAAGAGAGGGACCCGGTGGGAGG - Intronic
1046839412 8:118840747-118840769 CAGGAGAGAGAGACCGAGAGTGG + Intergenic
1046968684 8:120195777-120195799 CATGGGAGGGATGCAGTGGGAGG - Intronic
1046980397 8:120330593-120330615 CATGAGAGTGACGCAGTGGGAGG - Intronic
1047056760 8:121173718-121173740 CATGAGAGGGAACCCGTGGGAGG - Intergenic
1047080784 8:121458046-121458068 CATGGGAGGGATCCAGTGGGAGG + Intergenic
1047090320 8:121567192-121567214 CATGGGAGGGACATGGTGGGAGG - Intergenic
1047116101 8:121843113-121843135 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1047458658 8:125040557-125040579 CATGGGAGGGACCCAGTGGGAGG + Intronic
1047797726 8:128274772-128274794 CATGGGAGGGACGCGGTGGGAGG + Intergenic
1047827925 8:128597959-128597981 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1047859302 8:128947147-128947169 CCTGACAGGGAGACAGTTGGTGG - Intergenic
1048026109 8:130588419-130588441 CATGGGAGGGATCCAGTGGGAGG - Intergenic
1048210581 8:132451080-132451102 CATGGGAGGGACCCGGTGGGAGG + Intronic
1048418953 8:134258190-134258212 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1048633382 8:136268765-136268787 CATGGGAGGGAGCCAGTGGGAGG + Intergenic
1048801478 8:138198092-138198114 CATGGGAGGGACCCAGTGGGAGG + Intronic
1049036326 8:140078996-140079018 CATGGGAGGGACCCAGTGGGAGG + Intronic
1049581956 8:143416702-143416724 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1049614253 8:143569264-143569286 CCTGGGAGGGAGACTGGGGGCGG + Intronic
1049822235 8:144642598-144642620 CATGAGAGGGACCTAGTGGGAGG + Intergenic
1050055348 9:1647330-1647352 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1050120574 9:2303224-2303246 CATGGGAGGGACTCTGTGGGAGG - Intergenic
1050122399 9:2321051-2321073 CATGAGAGGTAGAAAGTGTGGGG + Intergenic
1050490903 9:6186822-6186844 CATTAGAGGGACCCAGTGGGAGG - Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1050666471 9:7943241-7943263 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1051128842 9:13836017-13836039 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1051243232 9:15082294-15082316 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1051251697 9:15165788-15165810 CATGGGAGGGACCCAGTGGGAGG - Exonic
1052062956 9:23983536-23983558 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1052088091 9:24292253-24292275 CATGAGAGGGATCTGGTGGGAGG - Intergenic
1052124383 9:24756749-24756771 CATGAGAGGGACCCAGTAGGAGG + Intergenic
1052552596 9:29970025-29970047 CATGGGAGGGAGACCGAAGGTGG - Intergenic
1052721523 9:32176407-32176429 TGTGAGAGGGAGCCAGTGGGAGG - Intergenic
1053016954 9:34667314-34667336 AATGAGAGGGAGAAAGAGGGTGG - Intergenic
1053556954 9:39146964-39146986 CATGGGAGGGAACCTGTGGGAGG + Intronic
1053821064 9:41967234-41967256 CATGGGAGGGAACCTGTGGGAGG + Intronic
1054089935 9:60835373-60835395 CATGGGAGGGAACCTGTGGGAGG + Intergenic
1054111346 9:61110931-61110953 CATGGGAGGGAACCTGTGGGAGG + Intergenic
1054609511 9:67220194-67220216 CATGGGAGGGAACCTGTGGGAGG - Intergenic
1054999531 9:71433257-71433279 CATGGGAGGGACCCAGTGGGAGG + Intronic
1055341771 9:75292243-75292265 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1055449985 9:76422175-76422197 CGTGAGAGGGACCCGGTGGGAGG - Intronic
1055839554 9:80486063-80486085 CATGAAATGGAGACCCCGGGAGG - Intergenic
1055877675 9:80962813-80962835 TATGAGAGGGACCCTGTGGGAGG - Intergenic
1055998660 9:82190807-82190829 CATGAGAGGGACCCAGGGGGAGG + Intergenic
1056042699 9:82684972-82684994 CATGGGAGGGACCTCGTGGGAGG - Intergenic
1056091932 9:83214600-83214622 CATGGGAGGGACCCTGTGGGAGG + Intergenic
1056215582 9:84403237-84403259 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1056822243 9:89851445-89851467 CAAGAGAGGGTGGCCATGGGGGG + Intergenic
1056886886 9:90451408-90451430 CATAAGAGGGACCCAGTGGGAGG + Intergenic
1056960869 9:91121840-91121862 CATGGAAGGGACACGGTGGGAGG + Intergenic
1056999487 9:91494309-91494331 CATGAGAGGGACCTGGTGGGAGG - Intergenic
1057194797 9:93110951-93110973 CATGAGAGAGAGACGGAGGAAGG - Intronic
1057479686 9:95434740-95434762 CATGAGAAGCAGACTGTGAGAGG - Intergenic
1058123943 9:101170475-101170497 CATGGGAGGGACCCAGTGGGAGG - Intronic
1058279805 9:103099820-103099842 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1058462419 9:105195584-105195606 CCTGAGAGGGACCCAGTGGGAGG - Intergenic
1058592639 9:106582087-106582109 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1058642980 9:107105225-107105247 CATGAGAGGGAGTCTGCTGGGGG - Intergenic
1058736168 9:107896144-107896166 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1058809872 9:108629254-108629276 CATGGGAGGGACCCGGTGGGAGG + Intergenic
1058810151 9:108631209-108631231 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1058921885 9:109624743-109624765 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1059474671 9:114535544-114535566 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1059601551 9:115784122-115784144 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1059794356 9:117675795-117675817 CAAGAGAGGGACCCGGTGGGAGG + Intergenic
1059843571 9:118245844-118245866 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1059904274 9:118964469-118964491 CATGGGAGGGACCCGGTGGGAGG - Intergenic
1060273664 9:122166179-122166201 CATGGGAGGGACTCAGTGGGAGG - Intronic
1060481669 9:124019856-124019878 CATGAGGAGGCGACCTTGGGAGG + Intronic
1060830220 9:126709042-126709064 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1061041352 9:128142632-128142654 GAAGAGAAGGAGACAGTGGGAGG + Intergenic
1061436040 9:130562816-130562838 CATGAGAGGGAACCGGTGGGAGG - Intergenic
1061754496 9:132803190-132803212 CATGGGAGGGACCCGGTGGGAGG - Intronic
1061908936 9:133712743-133712765 CATGGGTGGGGGACCCTGGGGGG - Intronic
1185550147 X:976479-976501 CATGAGAGGGACCCAGTGGGAGG - Intergenic
1185699931 X:2223173-2223195 CAAGGGAGGGAGCCAGTGGGAGG + Intronic
1185882172 X:3751211-3751233 CATGGGAGGGAGCCAGTGGGAGG - Intergenic
1185935933 X:4257282-4257304 CATGAGAGGGAGGCCAAGGAAGG + Intergenic
1185986410 X:4839459-4839481 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1186011021 X:5133324-5133346 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1186042128 X:5492225-5492247 CCTGGGAGGGACACTGTGGGAGG + Intergenic
1186042907 X:5501539-5501561 CATGGGAGGGACATGGTGGGAGG + Intergenic
1186114025 X:6286407-6286429 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1186138044 X:6540468-6540490 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1186143611 X:6602845-6602867 CATGGGAGGGACCCGGTGGGAGG + Intergenic
1186174108 X:6907093-6907115 AATGGGAGGGAGACGGTGGGAGG + Intergenic
1186233190 X:7478358-7478380 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1186255311 X:7711839-7711861 CATGGGAGGGACCCTGTGGGAGG - Intergenic
1186459946 X:9740034-9740056 CAGGAGAAGGAGAAAGTGGGAGG + Intronic
1186629426 X:11333242-11333264 CATGGGAGGGACCCGGTGGGAGG + Intronic
1186675909 X:11817139-11817161 CATGGGAGGGACCCGGTGGGAGG - Intergenic
1187214523 X:17263710-17263732 CAAGAGAGGGACCCAGTGGGAGG + Intergenic
1187214804 X:17265585-17265607 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1187433394 X:19244965-19244987 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1187560862 X:20402209-20402231 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1187598270 X:20798940-20798962 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1187638002 X:21254286-21254308 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1187683614 X:21794052-21794074 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1187693478 X:21894918-21894940 CATGGGAGGGACTCAGTGGGAGG + Intergenic
1188062367 X:25617432-25617454 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1188062639 X:25619323-25619345 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1188134745 X:26482361-26482383 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1188135029 X:26484292-26484314 CATGGGAGGGACCCGGTGGGAGG + Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188456992 X:30378691-30378713 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1188457283 X:30380656-30380678 CATGCGAGGGACCCAGTGGGAGG + Intergenic
1188624171 X:32264091-32264113 CATGGGAGGGATCCAGTGGGAGG + Intronic
1188735894 X:33715259-33715281 CATGGGAGGGACCCGGTGGGAGG - Intergenic
1188761751 X:34041148-34041170 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1188781927 X:34295815-34295837 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1188796151 X:34468253-34468275 CATGGGAGGGACCCGGTGGGAGG + Intergenic
1189384474 X:40526135-40526157 CGTGGGAGGGAGCCAGTGGGAGG - Intergenic
1189647508 X:43149619-43149641 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1189650985 X:43189246-43189268 CAAGAGAGGGACATGGTGGGAGG - Intergenic
1189740046 X:44108262-44108284 CATGGGAGGGAGTAAGTGGGAGG - Intergenic
1189798060 X:44664795-44664817 CATAAGAGGGACCCTGTGGGAGG - Intergenic
1189815619 X:44821900-44821922 CATGGGAGGGACCCCATGGGAGG + Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1189940125 X:46112781-46112803 CATGAGACGGAGGCCCTGCGGGG - Intergenic
1190514433 X:51207837-51207859 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1190590888 X:51999580-51999602 CATGGGAGGGACTCAGTGGGAGG + Intergenic
1190713745 X:53087569-53087591 AATGAGAGGGAGATGGAGGGAGG - Intronic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1190912576 X:54786616-54786638 CATGGGAGGGGGCCTGTGGGAGG - Intronic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1191837096 X:65475866-65475888 CATGGGAGGGACCCAGTGGGAGG - Intronic
1192057196 X:67785037-67785059 CATGAGAGTGAGAAAGTGGCAGG - Intergenic
1192161105 X:68788447-68788469 CATGAGAGGGAGATGGTAAGTGG + Intergenic
1193143615 X:78055005-78055027 CATGAGAGGGACCTGGTGGGAGG + Intergenic
1193978104 X:88148872-88148894 CATGATATTGAGACAGTGGGTGG - Intergenic
1194004585 X:88474770-88474792 CAAGAGAGAGAGACAATGGGGGG + Intergenic
1194097190 X:89656378-89656400 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1194259591 X:91677339-91677361 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1194259642 X:91677662-91677684 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1194299285 X:92164773-92164795 CATGGGAGGAACACGGTGGGAGG + Intronic
1194469216 X:94271875-94271897 CATGAGAGGGACCTGGTGGGAGG + Intergenic
1194756441 X:97744171-97744193 CATGGGAGGGACACTGTGGAAGG + Intergenic
1194778070 X:97990560-97990582 CATGAGAGGGACCCAGTGGGAGG - Intergenic
1194870353 X:99124157-99124179 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1194893135 X:99405592-99405614 CATGAGTGGGATCCTGTGGGAGG + Intergenic
1194906070 X:99577234-99577256 CATGGGAGGGACTCAGTGGGAGG + Intergenic
1194929269 X:99866767-99866789 CATGGGAGGGACCCAGTGGGAGG + Intergenic
1196315031 X:114212081-114212103 CATGGGAGGGACCCGGTGGGAGG - Intergenic
1196326216 X:114406600-114406622 CGTGAGAGGGATCCAGTGGGAGG + Intergenic
1196556469 X:117090640-117090662 CATGGGAGGGACATGGTGGGAGG - Intergenic
1196576354 X:117323301-117323323 CATGGGAGGGACCCAGTGGGCGG + Intergenic
1196600995 X:117601834-117601856 CATGAGAGGAACCCAGTGGGAGG - Intergenic
1196941101 X:120776785-120776807 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1196967664 X:121076247-121076269 CATGGGAGGGACCCAGTGGGGGG + Intergenic
1196985959 X:121271124-121271146 CATGTCAGGGAGACAGGGGGAGG + Intergenic
1197058777 X:122152713-122152735 CATGGGAGGGACCCGGTGGGAGG + Intergenic
1197059048 X:122154687-122154709 CATGAGAGGGACCAAGTGGGAGG + Intergenic
1197349936 X:125370973-125370995 CATGAGAGAGACCCAGTGGGAGG - Intergenic
1197869318 X:131050535-131050557 CAGGAGAGGGGGTCCTTGGGTGG + Intergenic
1197977705 X:132182995-132183017 CATGGGAGGGACCCGGTGGGAGG - Intergenic
1198189445 X:134287909-134287931 CATGGGAGGGAGGCAGAGGGGGG + Intergenic
1198425226 X:136511909-136511931 GATGAGAGGGGGACTTTGGGTGG + Exonic
1198477039 X:137005167-137005189 CATGGGAGGGACTCAGTGGGAGG - Intergenic
1198527452 X:137516117-137516139 CATGGGAGGGAACCGGTGGGAGG - Intergenic
1198569028 X:137935322-137935344 CATGGGAGGAAGCCAGTGGGAGG + Intergenic
1198810383 X:140530346-140530368 CATGGGAGAGAGCCAGTGGGAGG - Intergenic
1198987679 X:142474653-142474675 CAGGAGAGAGAGAGAGTGGGAGG - Intergenic
1198992251 X:142528119-142528141 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1199003154 X:142663769-142663791 CATGTGAGGGACCCAGTGGGAGG + Intergenic
1199006862 X:142709947-142709969 CATGAAAGGGACCCAGTGGGAGG + Intergenic
1199280119 X:145991725-145991747 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1199400829 X:147396262-147396284 CATGGGAGGGAACCAGTGGGAGG + Intergenic
1199555308 X:149101757-149101779 AATCAGAGAGAGAGCGTGGGAGG - Intergenic
1199751379 X:150822911-150822933 CATGGGAGGGACCCAGTGGGAGG + Intronic
1200578346 Y:4916855-4916877 CATGGGAGGGACCCAGTGGGAGG - Intergenic
1200637497 Y:5675308-5675330 CATGGGAGGGACCCAGTGGGAGG - Intronic
1200782798 Y:7232000-7232022 CATGGGAGGGAACCAGTGGGAGG + Intergenic
1201069159 Y:10128599-10128621 CATGGGAGGGAACCAGTGGGAGG - Intergenic
1201617080 Y:15912534-15912556 CATGGGAGGGAACCTGTGGGAGG + Intergenic
1201629559 Y:16055099-16055121 CATGAGAGGGACACAGTGAGAGG - Intergenic
1201668537 Y:16488583-16488605 CATGGGAGGGACACAGTGGGAGG - Intergenic