ID: 1090792378

View in Genome Browser
Species Human (GRCh38)
Location 11:130102532-130102554
Sequence CCTGCAGCCAGATTTGATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090792373_1090792378 4 Left 1090792373 11:130102505-130102527 CCCTCTATGGCAGGCACCTTCAG 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1090792378 11:130102532-130102554 CCTGCAGCCAGATTTGATCCTGG 0: 1
1: 0
2: 0
3: 4
4: 179
1090792370_1090792378 25 Left 1090792370 11:130102484-130102506 CCATGTTCATGGGAAGATGCTCC 0: 1
1: 0
2: 1
3: 8
4: 137
Right 1090792378 11:130102532-130102554 CCTGCAGCCAGATTTGATCCTGG 0: 1
1: 0
2: 0
3: 4
4: 179
1090792374_1090792378 3 Left 1090792374 11:130102506-130102528 CCTCTATGGCAGGCACCTTCAGA 0: 1
1: 0
2: 0
3: 15
4: 125
Right 1090792378 11:130102532-130102554 CCTGCAGCCAGATTTGATCCTGG 0: 1
1: 0
2: 0
3: 4
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090792378 Original CRISPR CCTGCAGCCAGATTTGATCC TGG Intronic
900345835 1:2209900-2209922 GCTGCAGCCAGGTTCCATCCAGG + Intronic
900472592 1:2862088-2862110 CCTGCAGACAGACCTGCTCCCGG + Intergenic
900896312 1:5485344-5485366 CTTGCAAACAGATTTGAACCTGG - Intergenic
901571564 1:10165103-10165125 TCTGCAGTCAGATCTGAGCCAGG - Intronic
901628371 1:10636145-10636167 CCAGCATCCGGATTGGATCCGGG + Intergenic
902628438 1:17690258-17690280 CCTGGAGCCAGAATTCCTCCTGG + Intronic
903068298 1:20713604-20713626 CCTGCTGCCAGGTCTGACCCTGG + Intronic
904092865 1:27957285-27957307 CCTGCATCCAGAATTCATCTGGG - Intronic
904197435 1:28796302-28796324 TATGCAGCCAGATTCCATCCTGG + Intergenic
904910440 1:33930615-33930637 CATGCAGCCTTCTTTGATCCAGG + Intronic
905003539 1:34692770-34692792 CCTGCAGGGGGATTTGTTCCGGG - Intergenic
907242611 1:53089091-53089113 CCTGCAGCCAGATGGCTTCCTGG + Intronic
908717950 1:67090060-67090082 CAAGCAGCCAGATTTCAGCCAGG - Intergenic
908933584 1:69346028-69346050 CTTGCAGCTAAATTTGATGCCGG + Intergenic
909496619 1:76286099-76286121 TCTTCAGACATATTTGATCCTGG - Intronic
910600152 1:89022540-89022562 GCTGCAGCCTAATTTGGTCCTGG + Intronic
911739112 1:101368188-101368210 CCTGAAGTCAGACTTGATCATGG + Intergenic
913207711 1:116556369-116556391 AATGAAGCCAGATTTGAACCTGG + Intronic
913608881 1:120491774-120491796 TCTGCAGCCACAATTGCTCCTGG + Intergenic
914582312 1:149030064-149030086 TCTGCAGCCACAATTGCTCCTGG - Intronic
915839093 1:159201190-159201212 CCTGGAGACAGATTTGATTTGGG - Exonic
916821474 1:168402985-168403007 TCGGCAGCCAGACTTGATTCTGG + Intergenic
920381739 1:205538643-205538665 CCAGCAGCCAGATCTGCACCTGG + Intergenic
921110375 1:212030736-212030758 TCAGCAGCCAGATTTGTTCCAGG - Intronic
922348620 1:224717663-224717685 CCTCCTGCCATATTTAATCCAGG + Intronic
922536954 1:226388413-226388435 CCTGCAGCCAGGCTTGAGCAAGG - Intronic
923055763 1:230425458-230425480 CCTGCAGCCTCATTTGTTTCCGG + Intronic
924282271 1:242450473-242450495 CTTGGAGCCTGATTTGTTCCAGG + Intronic
924599634 1:245477383-245477405 CCTTCAGGCAGCTTAGATCCTGG + Intronic
924768364 1:247055005-247055027 CCTGCAGCCTGATTTTTTTCAGG - Intronic
1065133043 10:22641896-22641918 TCTGCAGCCAGAATTGTTCAGGG + Intronic
1066066634 10:31765707-31765729 CCTGCGGCCAGCTCTGTTCCTGG - Intergenic
1067746052 10:48937394-48937416 CCTGGAGCAAGATCTGGTCCTGG + Intronic
1068699443 10:60004164-60004186 CCTGGAGCCAGCTCTGATCATGG - Intergenic
1069609462 10:69763009-69763031 AGTGCAGCCAGACTTGATCTCGG - Intergenic
1070365763 10:75735354-75735376 CCTGCAGCTAGCTTTGCTCAGGG + Intronic
1070830874 10:79417426-79417448 CCTGCAGCCTGATTTCTGCCAGG + Intronic
1071531083 10:86390754-86390776 GTTGCAGCCAGCCTTGATCCTGG + Intergenic
1072800420 10:98388856-98388878 CAAGCAGCCAGATTTCAGCCAGG + Intronic
1074059398 10:109951048-109951070 CCTGCCCACAGATTTGATGCAGG - Intronic
1074156370 10:110803869-110803891 CCTGCAGCCAGATCTACTCCTGG - Intronic
1074399285 10:113128568-113128590 CCTGCTGCCACATGGGATCCTGG - Intronic
1076463957 10:130665801-130665823 TATGCAGCCAGATTTGTTCTTGG - Intergenic
1087836324 11:102878973-102878995 TCTGCAGCCAGATGAGATTCTGG - Intergenic
1088526712 11:110763620-110763642 CCTGCAGCCTGATTTCAGCTGGG + Intergenic
1090792378 11:130102532-130102554 CCTGCAGCCAGATTTGATCCTGG + Intronic
1090880622 11:130828945-130828967 CCCGCAGCCAAATGTGAACCAGG - Intergenic
1091498157 12:990711-990733 CCAGCAGCCAGGGTCGATCCCGG + Intronic
1093435176 12:19128764-19128786 CCTACAGCCAGTTTGAATCCAGG + Intergenic
1093997493 12:25657658-25657680 CCTGCTGCCTGTTTTGATGCAGG + Intergenic
1094017752 12:25883182-25883204 GCTGCAGCCAGATTTAATGTGGG + Intergenic
1095719022 12:45380313-45380335 CATGCAGCCAAGTCTGATCCAGG - Intronic
1098002254 12:65957567-65957589 CCTGCAGTAAGAATTGAACCTGG + Intronic
1098467562 12:70805418-70805440 CCTGGAGTCAGCTATGATCCTGG + Intronic
1098743083 12:74200103-74200125 CCTGTACCCACATTTTATCCAGG - Intergenic
1101835213 12:108290252-108290274 TCTGCAGCCTCATTTGAGCCAGG + Exonic
1102247997 12:111367320-111367342 CCTGCAGGCAGAAATGACCCAGG - Intronic
1103527369 12:121577829-121577851 CCTGCAGCCAGTGTGGCTCCTGG - Intronic
1103709215 12:122898520-122898542 TCTGAAGCCAGTTTTGTTCCTGG - Intergenic
1108381538 13:49859550-49859572 CCTGCAGACATATTTGATGGTGG + Intergenic
1111647419 13:91048258-91048280 CCTCCAGCCAGATTTGCCCATGG - Intergenic
1114032033 14:18586602-18586624 CCTGCAGCCAGATATCCACCTGG + Intergenic
1114076812 14:19165632-19165654 CCTGCAGCCAGATATCCACCTGG + Intergenic
1114085349 14:19233936-19233958 CCTGCAGCCAGATATCCACCTGG - Intergenic
1114676072 14:24441099-24441121 CCTGCAACCAGAGTTCCTCCAGG - Exonic
1115724602 14:36199304-36199326 CATGCAGCCATATTTCCTCCTGG + Intergenic
1116849963 14:49898833-49898855 GCTGCAGCCAGATTTGCCCTTGG - Intergenic
1202896910 14_GL000194v1_random:15644-15666 CCTGCAGCCAGATATCCACCTGG - Intergenic
1129719463 15:77870196-77870218 CCTGCTGCCTGATTTGCTGCGGG + Intergenic
1132398432 15:101490179-101490201 CCTTCAGCCAGGCTTGGTCCCGG - Intronic
1133034157 16:3025701-3025723 CCTGCAGACAGAGGTGTTCCAGG + Exonic
1133752600 16:8736409-8736431 CCTGCAGGCAGAGTGGCTCCAGG - Intronic
1133816197 16:9199089-9199111 CCAGCAGGCAGATGTGCTCCTGG - Intergenic
1137669143 16:50269282-50269304 TCTGCTGCCACATTTGAGCCTGG + Intronic
1140690581 16:77479443-77479465 CTTGCAGCCAGGTTTGGCCCTGG - Intergenic
1147388790 17:40096958-40096980 CCTGAAGCCAGAATAGGTCCTGG + Intronic
1150170387 17:62987612-62987634 ACTCCAGGCAGATCTGATCCAGG + Intergenic
1151330518 17:73404192-73404214 CCTGCTGCCATCTTGGATCCAGG - Intronic
1152271499 17:79327511-79327533 GGTGCAGCCTGATTTCATCCCGG - Intronic
1152464476 17:80458106-80458128 CCAGCAGCCAGCTTTGGTCTTGG - Intergenic
1152928501 17:83098741-83098763 CCTGCAGCCAGCTTTCCTTCTGG - Intergenic
1156339343 18:36197170-36197192 CCTGCAGAAATAATTGATCCCGG - Intronic
1157331873 18:46710153-46710175 CCAGCAGCCAAATATGATGCTGG + Intronic
1157664464 18:49474114-49474136 CCTGCATCCTGATTTTAGCCTGG + Intergenic
1160846827 19:1169654-1169676 CCTGCAGCCAGCTTGCATCAAGG - Intronic
1160908758 19:1465164-1465186 TCTGCAGACAGTTGTGATCCCGG - Exonic
1161763979 19:6196396-6196418 CCTGCTGCCAGACTTGCCCCTGG + Intronic
1163525023 19:17815609-17815631 CCTGCAGCCCCATCTCATCCAGG - Intergenic
1164983293 19:32630247-32630269 CCTGGAGCCAGAGTGGGTCCTGG - Intronic
1165092246 19:33393332-33393354 GCTGCAGCCAGAGTTGCCCCAGG - Intronic
926223625 2:10952301-10952323 GCTGCAGCCAGCTTTTATGCTGG + Intergenic
928324518 2:30309025-30309047 CCTCCACCCAGAGTTGATGCTGG - Intronic
929262493 2:39881388-39881410 CCTGGAGCCAGATTTATTTCAGG + Intergenic
930917399 2:56710018-56710040 CCTGGAGGCAGATTTCATCTTGG + Intergenic
931718917 2:65053064-65053086 CCAGGAGCCAGATTTCATTCTGG - Intergenic
933632316 2:84672136-84672158 CCTGCAGGAAGATGTGGTCCTGG - Intronic
933829411 2:86195039-86195061 CCAGCAGCCAGGATTGGTCCTGG + Intronic
934036519 2:88092927-88092949 CTAGCAGCCACATTTTATCCAGG + Intronic
938491411 2:131763141-131763163 CCTGCAGCCAGATATCCACCTGG + Intronic
938496150 2:131799182-131799204 CCTGCAGCCAGATATCCACCTGG - Intronic
938884728 2:135632857-135632879 CCTGAAGCCAGATTTCTCCCAGG + Intronic
939190253 2:138908945-138908967 CCTACAGCCAGAATTGATGCTGG + Intergenic
940707574 2:157124705-157124727 CCTGGATCCAGATTTGATAAAGG - Intergenic
941434388 2:165451145-165451167 CCTACAGTCAGATAAGATCCAGG - Intergenic
941778529 2:169419097-169419119 CCTCCAGCTAGATTTTATTCAGG + Intergenic
944544370 2:200784521-200784543 CCAGGAGGCAGCTTTGATCCAGG - Intergenic
946006480 2:216529512-216529534 CCAGGAGACAGATTTGAGCCAGG + Intronic
947949384 2:234134542-234134564 CCTGCAGCCAGAATCAAGCCCGG + Intergenic
948450154 2:238064390-238064412 CCTGGAGCCAGAAGTTATCCAGG + Exonic
949044032 2:241862435-241862457 GCAGCAGCCAGATTCAATCCAGG + Intergenic
1169785358 20:9354048-9354070 CCTGCTGCCTGATGAGATCCTGG + Intronic
1171031994 20:21685096-21685118 CCTGAACCAAGATTTGAACCTGG - Intergenic
1172535359 20:35668802-35668824 CCAGGAGCCAGATTTGTTCTGGG - Exonic
1174807610 20:53618009-53618031 CCTGCAGCCCGGTTTAATTCTGG - Intergenic
1175903275 20:62368235-62368257 CCTGGAGGCAGATTTGGCCCCGG - Intergenic
1176616598 21:9031640-9031662 CCTGCAGCCAGATATCCACCTGG - Intergenic
1176708531 21:10131992-10132014 CCTGCAGCCAGATATCCACCTGG + Intergenic
1178802684 21:35810840-35810862 CCTTCAGGCTGATTTGATCTAGG + Intronic
1180292622 22:10859257-10859279 CCTGCAGCCAGATATCCACCTGG + Intergenic
1180456146 22:15513659-15513681 CCTGCAGCCAGATATCCACCTGG + Intergenic
1180495427 22:15888679-15888701 CCTGCAGCCAGATATCCACCTGG + Intergenic
1184204268 22:42991316-42991338 CCTGCAGCCAGCTGAGACCCAGG - Intronic
1184727547 22:46355637-46355659 CCTGAGGCCAGATTTGGGCCAGG + Intronic
952715490 3:36476003-36476025 CCTGTAGGCAGACTTGAACCTGG + Intronic
953070966 3:39519100-39519122 CCTGCATCAAGATTTCTTCCTGG - Intronic
953699419 3:45184370-45184392 CCTCCAGCCACCTTTGATCTGGG - Intergenic
955802380 3:62699537-62699559 TCATCAGCCAGATTTGACCCAGG - Intronic
959549485 3:107638524-107638546 CCTGCAGAAAGAATTGTTCCAGG - Intronic
961912240 3:130330033-130330055 CCTGCAGCCAGCATTGTTCTGGG + Intergenic
962480350 3:135792695-135792717 CCTGAAGGCAGATGTGATGCTGG - Intergenic
965456546 3:168908392-168908414 ACTGGAGCCAGATGTGATGCTGG + Intergenic
967153542 3:186671827-186671849 CCTGCTGCCAGGTTGGAGCCTGG - Intronic
967155709 3:186690130-186690152 CCTGCTGCCAGGTTGGAGCCTGG - Intergenic
967156998 3:186702295-186702317 CCTGCTGCCAGGTTGGAGCCTGG - Intergenic
969456432 4:7302459-7302481 CCTGCAGCCAGATGTCTGCCTGG + Intronic
977555654 4:98485192-98485214 CCTGTAGCCTGATTGGGTCCTGG - Intronic
982440275 4:155427007-155427029 CCTTCAGCCAGATTTATTACTGG - Intergenic
987426533 5:17779153-17779175 CCTACAGCCATATTTTGTCCTGG + Intergenic
987839035 5:23198930-23198952 CCTGCAGAGATTTTTGATCCAGG - Intergenic
995413087 5:111880404-111880426 CCTGCTGACATATTTGATCTTGG - Intronic
997626866 5:135337008-135337030 CCTGCAGCCCCCGTTGATCCAGG - Intronic
1004151399 6:13123524-13123546 CCTACAGCCAGCTTTGATGAGGG + Intronic
1006015592 6:31078346-31078368 CCAGCAGCCAGACTTGCCCCAGG + Intergenic
1006562642 6:34926957-34926979 CCTGGAGCCAGAATTCAACCTGG - Intronic
1006673793 6:35747407-35747429 CCTGCAGTCAGACTACATCCTGG + Exonic
1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG + Exonic
1010833165 6:80555485-80555507 TCTGCAACCAGCTTTGACCCAGG + Intergenic
1012258851 6:97064633-97064655 GCTGGAGCCAGGTGTGATCCAGG + Exonic
1013062363 6:106647602-106647624 CCTGACTCTAGATTTGATCCAGG + Intronic
1013944210 6:115703561-115703583 CCTGCAGACAGGCTTGATACTGG + Intergenic
1016827139 6:148398981-148399003 CTTGGTGCCAGATTTGATCTTGG + Intronic
1016842023 6:148534205-148534227 CCAGCAGCAAGGTTTGACCCGGG - Intronic
1024478497 7:49839561-49839583 CCTCCAGCCAGATCTTGTCCAGG - Intronic
1027226410 7:76246708-76246730 CCAGTAGCCAGATGTCATCCCGG - Intronic
1029499711 7:100921211-100921233 CCTGCAGGCAGAATTGCTTCTGG + Intergenic
1030348486 7:108457713-108457735 CCAGCAGCCAGATATCATGCTGG - Intergenic
1035839164 8:2792129-2792151 CCTGAAGACAGGTTTGATCTGGG + Intergenic
1037090590 8:14911613-14911635 TCTGCAGCCAGATTTTATTATGG - Intronic
1041208057 8:55518608-55518630 CCTACAGCCAGATTGCTTCCAGG + Intronic
1044427991 8:92075283-92075305 CCTGTAGCCAGCTCTGTTCCAGG - Intronic
1044477231 8:92642087-92642109 CCAGCAGCCAGATTTGAGTATGG + Intergenic
1044513391 8:93110107-93110129 CCTGCAGCCAGCTCTCTTCCTGG - Intergenic
1050253473 9:3770247-3770269 CTTGTAGCCAGCTTTTATCCAGG + Intergenic
1052816622 9:33107017-33107039 CCTGCAGCGAGATGTGTTCCAGG - Intronic
1053645498 9:40117505-40117527 CCTGCAGCCAGATATCCACCTGG + Intergenic
1053760216 9:41346022-41346044 CCTGCAGCCAGATATCCACCTGG - Intergenic
1054326516 9:63715406-63715428 CCTGCAGCCAGATATCCACCTGG + Intergenic
1054539075 9:66258467-66258489 CCTGCAGCCAGATATCCACCTGG - Intergenic
1055052704 9:71996017-71996039 CCTGCAGCCACCTTTAATGCAGG - Intergenic
1058686818 9:107487763-107487785 CCTGCGGCCAGAATTGGACCCGG - Exonic
1059217700 9:112581553-112581575 CCTGCACCCAGATCTGGCCCTGG - Intronic
1059349754 9:113656312-113656334 GATGCAGCTAGATTTGAACCTGG + Intergenic
1059377653 9:113898486-113898508 GCTGCAGGGAGATATGATCCAGG - Intronic
1202793292 9_KI270719v1_random:100961-100983 CCTGCAGCCAGATATCCACCTGG + Intergenic
1187815447 X:23226691-23226713 ACTGCAGCAAGACTTGATGCTGG - Intergenic
1187963927 X:24592335-24592357 TCTGTGGCCAGATTTGATTCTGG - Intronic
1191269357 X:58443276-58443298 CCTGCTTCCAGTTTTTATCCTGG + Intergenic
1192306122 X:69961416-69961438 TCTGCAGCCTGATTTGTTCTTGG - Intronic
1193996847 X:88375683-88375705 CCTCCAGCCCGACTTGATCATGG + Intergenic
1197653019 X:129086339-129086361 GCTCCAGGCAGATCTGATCCAGG - Intergenic
1197771953 X:130094857-130094879 CGTGCCGCCAGCTTTGAGCCAGG - Intronic
1198601841 X:138292241-138292263 CCTGCAGTCAGACATAATCCAGG + Intergenic
1199427379 X:147718512-147718534 CCAGCAGCCAGATTTTTTTCAGG + Intergenic
1201150006 Y:11090491-11090513 CCTGCAGCCAGATATCCACCTGG - Intergenic