ID: 1090793713

View in Genome Browser
Species Human (GRCh38)
Location 11:130115487-130115509
Sequence TCACAGGGATGATTAGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 319}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090793709_1090793713 20 Left 1090793709 11:130115444-130115466 CCATAGCACTGCTGGAGAGAAGT 0: 1
1: 0
2: 0
3: 13
4: 165
Right 1090793713 11:130115487-130115509 TCACAGGGATGATTAGAAATTGG 0: 1
1: 0
2: 0
3: 29
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090793713 Original CRISPR TCACAGGGATGATTAGAAAT TGG Intronic
900928322 1:5719855-5719877 TCACAAGGATCCTAAGAAATAGG + Intergenic
903297832 1:22356572-22356594 TCACAGGGAGCTTTAGGAATGGG - Intergenic
904312235 1:29636249-29636271 GCACAGGGATGGTGAGAAGTGGG + Intergenic
905291696 1:36926083-36926105 TCTCAGGGATCATAAGAAAATGG - Intronic
906644880 1:47467383-47467405 TCAAACGGATGGTTATAAATTGG - Intergenic
907742167 1:57177281-57177303 TCAAAGGGGTGGTTAGAACTTGG - Intronic
907974437 1:59417580-59417602 TCACAAGGATGTGGAGAAATTGG - Intronic
908658869 1:66417255-66417277 TCACAGGGAGGATTGAAAAAAGG - Intergenic
909482727 1:76142892-76142914 TCACATGGAGGATTAGATCTGGG + Intronic
909842729 1:80349172-80349194 TCACAGGGATGAGTGGCAGTGGG + Intergenic
910977986 1:92928089-92928111 TCACAAGGATGTGGAGAAATAGG - Intronic
911283829 1:95965106-95965128 TCACTGGGATTCCTAGAAATTGG + Intergenic
911379636 1:97096700-97096722 TCACAGGGAGGATTGAAAAAAGG + Intronic
911665626 1:100547996-100548018 TAACAGGGATAAGTAGAAAGGGG - Intergenic
911817120 1:102367896-102367918 ACAAAGAGATGATTTGAAATTGG + Intergenic
912223268 1:107701694-107701716 TGAGAGAGATGATTTGAAATTGG - Intronic
913383346 1:118233143-118233165 TCACAGGGAGGATTGTAAAAAGG + Intergenic
914712023 1:150223059-150223081 TCAAAGGGATCAGTAAAAATTGG + Intronic
914792460 1:150890434-150890456 TTACAGGAATGATTAGAAGGTGG + Intergenic
914907788 1:151761001-151761023 GCACAGGGATGAATAAAACTGGG + Intronic
916710178 1:167398240-167398262 TCTTATGGATGATTATAAATAGG + Intronic
916910470 1:169340907-169340929 TCACAGAGATGGTTTGAGATTGG + Intronic
917151148 1:171946310-171946332 TCAAAGGGGTGGTTAGAATTTGG + Intronic
917680196 1:177358071-177358093 TGACAGATATGATCAGAAATGGG + Intergenic
919177682 1:194039028-194039050 TCAAAGGGATTATTAGATATGGG - Intergenic
919256320 1:195129113-195129135 TCACAGAGAAGGTTTGAAATTGG - Intergenic
920159091 1:203982143-203982165 TCAAAGGGGTGTTTAGAACTTGG + Intergenic
924046964 1:240041736-240041758 TCACAGGCAGGATTAGAAGATGG - Intronic
1063227427 10:4028668-4028690 TCACTTGGATGATCAGCAATTGG - Intergenic
1063357045 10:5410928-5410950 TCACAGGGAGGATTGAAAAAAGG - Intergenic
1063958534 10:11286804-11286826 TCACAGGGATGCTTGAAAGTGGG - Intronic
1064588666 10:16865681-16865703 TCACAGGGAGGATTGAAAAAAGG + Intronic
1064774937 10:18766114-18766136 TCAGAAGGATTAGTAGAAATTGG + Intergenic
1065654821 10:27937823-27937845 CCACTGAGTTGATTAGAAATAGG - Intronic
1067200041 10:44160696-44160718 CCACAGAGATGTTTAGGAATGGG + Intergenic
1067531654 10:47078522-47078544 TCACAGGGAGGATTGAAAAAAGG - Intergenic
1068732527 10:60375325-60375347 TCTCAGGGACAATTAGAAGTAGG - Intronic
1069152708 10:64985015-64985037 TCACAGGGAGGATTGAAAAAAGG - Intergenic
1069696280 10:70387821-70387843 TCACCTGGATTACTAGAAATAGG + Intergenic
1071037878 10:81269090-81269112 TCACAGGGAGGATTGAAAAAAGG + Intergenic
1071662977 10:87524461-87524483 ACACATGGATGATAAGAAAGTGG - Intronic
1071782407 10:88860944-88860966 TCAAAGGGGTGGTTAGAATTTGG + Intergenic
1071861260 10:89675085-89675107 TCAAAGGGGTGGTTAGAACTTGG - Intergenic
1072078739 10:92006237-92006259 TCACAGAGATAGTTAGAAAAGGG + Intronic
1072287876 10:93934136-93934158 TGACAGGGATGAGGAGAATTCGG + Intronic
1075223724 10:120606485-120606507 TAAAAGCCATGATTAGAAATTGG + Intergenic
1075552686 10:123403706-123403728 TCACAGTCATGATTAAGAATGGG - Intergenic
1077604799 11:3602183-3602205 TCACAGGGGTGTTTACAAACAGG - Intergenic
1079676668 11:23236199-23236221 TCAGAAGGATGATAAGAAAAAGG - Intergenic
1080791880 11:35528499-35528521 TCAAAGAGATGGTTAGAATTTGG - Intronic
1081027659 11:38035721-38035743 ACACAGGGATGATTTGATAGTGG + Intergenic
1084200138 11:67551478-67551500 ACAAAGAGATGATTTGAAATTGG + Intergenic
1085867651 11:80313551-80313573 TCTCAAGGAAGATTAGAAAAAGG - Intergenic
1087846694 11:102981794-102981816 TCAAAGAGGTGATTAGAACTTGG + Intergenic
1088714493 11:112536917-112536939 TCAAAGGGATGGTTAGAATTTGG + Intergenic
1089110069 11:116048551-116048573 CTTCAGGCATGATTAGAAATGGG + Intergenic
1090793713 11:130115487-130115509 TCACAGGGATGATTAGAAATTGG + Intronic
1090940942 11:131387884-131387906 TCCCAGGGCAGATTAGAAACCGG - Intronic
1091666307 12:2420824-2420846 TCACAGTGATCGTGAGAAATAGG - Intronic
1092254201 12:6917347-6917369 TCTCAGGGATATTTAGAAAGAGG + Intronic
1093199121 12:16165757-16165779 TAGCAGGACTGATTAGAAATGGG + Intergenic
1094271000 12:28614459-28614481 TCACAAGGATGATGAAGAATGGG + Intergenic
1094338035 12:29382752-29382774 TCACTGGGTAGATTAGAAAATGG - Intergenic
1094343427 12:29439296-29439318 TCAAAGAGGTGATTAGAACTTGG - Intronic
1098051417 12:66457911-66457933 TCACAGGGATATTGAGAATTAGG + Intronic
1098143512 12:67474918-67474940 TCAAAGGGATGATTGGAATTTGG + Intergenic
1098722609 12:73921710-73921732 TCACATGGCTTATTAGAAGTTGG + Intergenic
1099097071 12:78387995-78388017 TCAGAGGGATGCTAAGAATTTGG + Intergenic
1099375950 12:81896665-81896687 TCACAGGGAGGATTGAAAAAAGG + Intergenic
1100121529 12:91374408-91374430 TCACATGAATGAATACAAATGGG - Intergenic
1100322669 12:93510579-93510601 TGACAGGGATGTTGAGCAATAGG - Exonic
1104115873 12:125748608-125748630 ACAAAGGGATGGTTTGAAATTGG + Intergenic
1104738543 12:131155139-131155161 TCTGAAGGTTGATTAGAAATTGG + Intergenic
1104777335 12:131398226-131398248 TCACAGAGATGGTTTGAAATTGG - Intergenic
1105599820 13:21876694-21876716 TCACAGGGAGAATTGGAAAAAGG - Intergenic
1105630556 13:22160715-22160737 TAAGAGTGATGATTAGAGATGGG + Intergenic
1106614653 13:31315550-31315572 TCACAGAGATGGTTTGAAATTGG + Intronic
1107104520 13:36629060-36629082 TCAAAGGGATCATTAGAACTTGG + Intergenic
1107330637 13:39296134-39296156 TGAGAGAGATGATTTGAAATTGG + Intergenic
1107623391 13:42257702-42257724 TGGCAGGGGTGAGTAGAAATGGG + Intergenic
1108172124 13:47752227-47752249 TGACAGGGATGATTAGGAGGAGG - Intergenic
1110398059 13:75055328-75055350 TACCAAGCATGATTAGAAATGGG + Intergenic
1111184636 13:84717361-84717383 TCACTGGGATAATTAGGTATGGG - Intergenic
1113184969 13:107677459-107677481 TCCCAGGAATAATTAGAATTGGG + Intronic
1113708516 13:112449113-112449135 TCACGGGGCTGAGTAGACATGGG + Intergenic
1114804417 14:25818111-25818133 TCCCAGGCATGATTAGACTTGGG - Intergenic
1115173708 14:30537744-30537766 TCAAAGGGGTGGTTAGAACTTGG - Intergenic
1116316164 14:43395395-43395417 TCATAGTGATGATTTGATATTGG - Intergenic
1117928580 14:60812875-60812897 TCACAGGGATGGTTAAAAGATGG - Intronic
1118127175 14:62919423-62919445 TCACAGGGATAAAACGAAATTGG + Intronic
1118128159 14:62932385-62932407 TCAAAAGAAGGATTAGAAATTGG + Intronic
1118903063 14:70002573-70002595 TCACATAGATGTTGAGAAATTGG + Intronic
1119875694 14:78057329-78057351 TCTCAGGAATGAGTAGAATTTGG + Intergenic
1120057288 14:79939376-79939398 GCATAGGGGTGATTAGGAATTGG - Intergenic
1121352200 14:93182950-93182972 TCACAAGGATGAATTTAAATAGG + Exonic
1123767255 15:23493790-23493812 TCACAGAGATGATTTGAAGTGGG + Intergenic
1124247872 15:28086028-28086050 TCACAGGGATGCTTCGCAAAAGG + Intronic
1124451719 15:29798999-29799021 GGACCGGGATGATTAAAAATAGG + Intronic
1126072368 15:44876166-44876188 TCACAGGGAGGATTGAAAAAAGG - Intergenic
1126374240 15:47979074-47979096 TAACAAGGATGAGGAGAAATGGG + Intergenic
1127884363 15:63186427-63186449 TCACAGCCATCATTAGAAAGAGG + Intergenic
1130385969 15:83412716-83412738 GGAAAGGGATGGTTAGAAATGGG + Intergenic
1132238683 15:100240743-100240765 ACAGAGGGGTGATTAGAACTTGG - Intronic
1133331757 16:4979163-4979185 GCACAGGGAGGGTCAGAAATGGG + Intronic
1138800176 16:60017146-60017168 ACAAAGGGATGATTTGAAATTGG - Intergenic
1141428114 16:83956735-83956757 GCACAGGGATGATGAGCATTTGG - Intronic
1143089791 17:4442893-4442915 TCACAGAAATGATTTGAATTAGG + Intronic
1144015858 17:11195328-11195350 TGACAGAGATGATAACAAATTGG - Intergenic
1147059935 17:37867664-37867686 TGACAGGAATGATTGGAAAATGG - Intergenic
1147720271 17:42535744-42535766 ACTCAGGGATGAATAGGAATTGG - Intergenic
1147836092 17:43332852-43332874 TCACCGGGCTGTGTAGAAATTGG + Intergenic
1148409208 17:47450151-47450173 TGACAGGAATGATTGGAAAATGG - Intergenic
1148502620 17:48103258-48103280 TCACAGGGAGGATTGAAAAAAGG + Intergenic
1149257614 17:54844522-54844544 TCACAGGGGTGATTTGACAAAGG - Intergenic
1151186611 17:72369435-72369457 TCACAGGTAAAACTAGAAATTGG + Intergenic
1155477078 18:26245527-26245549 TCACAGGGAAGATTGAAAAAAGG - Intronic
1155915061 18:31549372-31549394 TCAAAGGGGTGGTTAGAACTTGG + Intergenic
1156902601 18:42318837-42318859 TCAAAAGGATAATTAGAGATTGG + Intergenic
1157535624 18:48455450-48455472 TCACAGTGAGGATGAGAGATGGG - Intergenic
1157851712 18:51059898-51059920 TTACCAGGATGATTGGAAATGGG - Exonic
1158820930 18:61158033-61158055 TCACAGGGACCCTTAGAAAGGGG - Intergenic
1159377341 18:67610058-67610080 TCAGAATGATGTTTAGAAATTGG + Intergenic
1160329356 18:77977756-77977778 ACACAGGGATGGTGAGGAATGGG + Intergenic
1162236567 19:9314346-9314368 TCACAGGGAGGATTGAAAAAAGG - Intergenic
1164312911 19:24061767-24061789 TCACAGGTAGGCTTAGAAAGAGG + Intronic
1166064997 19:40352543-40352565 TCACAGGTATAAAGAGAAATAGG - Intronic
1167114002 19:47478204-47478226 ACACAGGGAGGGTTAGAGATTGG + Intronic
925661596 2:6208954-6208976 TGAGAGAGATGATTTGAAATTGG + Intergenic
926380583 2:12284287-12284309 TGACAGGGATGTGGAGAAATTGG + Intergenic
926713334 2:15901821-15901843 TCACAAGGATGCTGAGAAATTGG + Intergenic
927861280 2:26561743-26561765 TCACAGGGAGGATTACACAGGGG + Intergenic
928392868 2:30922596-30922618 TCTCAGAGATGAGTAGAAATAGG - Intronic
928665042 2:33542580-33542602 CCTCAGGGTTGAGTAGAAATTGG - Intronic
928673497 2:33626777-33626799 TCAAAGGGGTGGTTAGAATTTGG + Intergenic
928948109 2:36790257-36790279 TCACAGGACTGATGAGACATTGG + Intronic
929057792 2:37893469-37893491 TCAAAGGGATTGTTAGAACTTGG - Intergenic
930271951 2:49267700-49267722 TCACTGGGTTAAATAGAAATAGG + Intergenic
932960777 2:76409743-76409765 TCGCAGGGAGGATTGGAAAAAGG - Intergenic
933094349 2:78159549-78159571 TTACAGAGATGAGCAGAAATGGG - Intergenic
934700771 2:96438354-96438376 TCAAAGAGATGGTTTGAAATTGG + Intergenic
935226493 2:101057458-101057480 TCACAGGGGTGGTTAGCACTTGG - Intronic
935935906 2:108182775-108182797 ACAAAGGGATGGTTAGAACTTGG - Intergenic
936087913 2:109481849-109481871 TCACAAGGTTGATGAGCAATTGG + Intronic
936148568 2:109997717-109997739 TCACAGGGCTGGTCAGAAGTAGG - Intergenic
936249402 2:110855992-110856014 TCACAGGGAGGATTGAAAAAAGG - Intronic
936483746 2:112908720-112908742 TCACAGGGAGGATTGAAAAAAGG - Intergenic
936856821 2:116968127-116968149 TCAAAGGCATGGTTAGAACTTGG - Intergenic
940174000 2:150859181-150859203 TCACAGGTATAATTAGAACTTGG + Intergenic
940613766 2:156024881-156024903 TCAAAGTGATGATTAAATATGGG + Intergenic
941239700 2:163021254-163021276 TCACAAGGATGTGGAGAAATTGG - Intergenic
941356257 2:164496109-164496131 TCACATGGAAGATTATTAATAGG - Intronic
942008150 2:171730248-171730270 TCACAGAGTTGATGGGAAATAGG + Intronic
943124708 2:183782303-183782325 ACAAAGAGATGATTTGAAATTGG + Intergenic
943821569 2:192329759-192329781 TGACAGTGATGATTGGAATTAGG + Intergenic
944029133 2:195212423-195212445 TCACAGAGAAGATTAAAAAGTGG + Intergenic
944458238 2:199917471-199917493 TGAGAGGGATGGTTTGAAATTGG - Intronic
947904450 2:233750326-233750348 TCAGAGAGATGATCTGAAATTGG + Intronic
948435123 2:237948020-237948042 TCAGAGGGATATTTAGAACTGGG - Intergenic
948472209 2:238190615-238190637 TCAGAGGGATGTTTGAAAATGGG + Intronic
949038921 2:241836007-241836029 TCACAGGGAGGATTGAAAAAAGG - Intergenic
1172830861 20:37833289-37833311 TCTCAAGGATGATTAGCAAAGGG - Intronic
1174686401 20:52460021-52460043 CCACAGGGATGGGTAGAGATGGG - Intergenic
1177167673 21:17621212-17621234 TTACAGGCATGATGATAAATAGG + Intergenic
1177557077 21:22704357-22704379 TCACAAGGATGGTCTGAAATTGG + Intergenic
1177581315 21:23025618-23025640 TTACAGGGGTCATTAGAAAATGG + Intergenic
1177688076 21:24466005-24466027 TGAGAGAGATGATTTGAAATTGG + Intergenic
1181595413 22:23911416-23911438 TCACAGGGAGGCTTACAAAATGG - Intergenic
1182801715 22:33036995-33037017 TCAAAGGGGTGATTGGAACTTGG - Intronic
1182808879 22:33099011-33099033 TCAAAGGGGTGGTTAGAATTTGG - Intergenic
1183060158 22:35331525-35331547 CCACCGGGATGATGTGAAATGGG + Intronic
1183692927 22:39401207-39401229 TCACAGAGGTGAGTAGACATTGG + Intronic
1183831639 22:40421218-40421240 CCACAGGGAAGAGTGGAAATGGG - Intronic
949251753 3:1993444-1993466 TTGCACGGATGATAAGAAATTGG + Intergenic
949760925 3:7469658-7469680 TCACAGATATGATCAGAAACAGG - Intronic
951549973 3:23867468-23867490 ACACATGGAAGATTTGAAATGGG - Intronic
951570927 3:24062402-24062424 TCACTGAGCTGATTTGAAATTGG + Intergenic
952058706 3:29480883-29480905 TCACAGGGATGAATACCAATTGG + Intronic
952677971 3:36055806-36055828 TTGCAGGCATGAGTAGAAATAGG + Intergenic
953058995 3:39411503-39411525 TAACAGGGAGCATTATAAATAGG - Intronic
953456480 3:43046495-43046517 TCACAGAGATGGTTTGGAATTGG + Intronic
955087184 3:55714342-55714364 ACACAGGGATGAATACAAAAGGG + Intronic
955806357 3:62739527-62739549 TAACAAGGATCATTAGAAAGCGG - Intronic
956660584 3:71593149-71593171 TCACAGGGCTGCTGAGAAAATGG + Intergenic
956738185 3:72255272-72255294 TCACAGGCAGGAATAGAAAATGG - Intergenic
956973777 3:74556772-74556794 TGACAAGGATGAGGAGAAATTGG - Intergenic
957007606 3:74968506-74968528 TCACAGGAATTATAATAAATTGG + Intergenic
957386998 3:79508692-79508714 TCTCAGAGATAATTAGAAAACGG - Intronic
957815134 3:85288374-85288396 TTCCATGGATGATTTGAAATAGG + Intronic
957993346 3:87654204-87654226 TCATTGGGATGGTTAGATATTGG - Intergenic
959527995 3:107398907-107398929 TTACAGGGATGAGAAGAAAATGG - Intergenic
960221175 3:115110327-115110349 CCATAGGGATGATTCAAAATAGG + Intronic
961612645 3:128153048-128153070 TCACAGGGAGGATTGAAAAAAGG - Intronic
963420153 3:145051835-145051857 ACACAGAGATTATAAGAAATTGG - Intergenic
964073978 3:152671010-152671032 TCAAAATAATGATTAGAAATCGG + Intergenic
964180956 3:153885133-153885155 TCACAATAATGATAAGAAATGGG - Intergenic
964769722 3:160211682-160211704 TGACTGGGATGATTAGAACTAGG - Intergenic
965062402 3:163801847-163801869 TCACAGGGAGGATTAAAAAAAGG + Intergenic
965095071 3:164215841-164215863 TCACAGGAATGATCAAAAGTTGG + Intergenic
965346503 3:167557259-167557281 TCTCACAGATGATTAAAAATTGG + Intronic
965362603 3:167760060-167760082 TCAAAGGTATGATGAGAAACAGG - Intronic
965467164 3:169044458-169044480 TCACAGGATGGCTTAGAAATAGG + Intergenic
966333467 3:178841002-178841024 ACAAAGAGATGATTTGAAATTGG - Intronic
967708731 3:192681560-192681582 TCACAGGGATTTTTAGAGATTGG - Intronic
967981423 3:195068004-195068026 TAAGAGGGATGAGAAGAAATGGG + Intergenic
969944606 4:10770522-10770544 TCACAGGGATGTTTACCAGTAGG - Intergenic
970177662 4:13355555-13355577 TCAAGGGGATGTTTACAAATGGG + Intergenic
970886107 4:20989093-20989115 TCAAAGGGGTGCTTAGAATTGGG - Intronic
971160447 4:24128234-24128256 TCACAGGGAAGCTAAGTAATTGG - Intergenic
971203383 4:24535092-24535114 CCAAAGGGATGATTAGCCATTGG - Intronic
971311495 4:25529336-25529358 TTACAGGTATGATTAGAAAGAGG + Intergenic
971447846 4:26771198-26771220 TCACAACGATGTTGAGAAATTGG + Intergenic
972133635 4:35864851-35864873 TCACAGGGATGATTGAAAAAGGG - Intergenic
973909902 4:55569047-55569069 TCAAAGGGGTGGTTAGAACTTGG - Intronic
975081144 4:70281661-70281683 TCAGAGGGATAATTCAAAATAGG + Intergenic
976262412 4:83158251-83158273 TCACAGGGTTCAGGAGAAATTGG + Intergenic
976631963 4:87247958-87247980 TCACAGGGAGGATTGAAAAAAGG + Intergenic
978433345 4:108656492-108656514 TTAAAGGGATGATTATACATAGG - Intronic
978882413 4:113721986-113722008 TTAAAGGGATCATTAGAATTTGG - Intronic
979897370 4:126176429-126176451 TCTAAGGGATGATTAGCAAGCGG - Intergenic
980045558 4:127984350-127984372 TCAGAAAGATGATTGGAAATCGG + Exonic
980170147 4:129279675-129279697 TCATAGGGATTAATAAAAATGGG + Intergenic
980715919 4:136629671-136629693 TCACAAAGATGATTCAAAATTGG + Intergenic
982183855 4:152776892-152776914 TCACAGGGAGGATAAATAATGGG + Intronic
982486183 4:155968386-155968408 TCACAGGGAGGATTGAAAAAAGG - Intergenic
982513522 4:156315589-156315611 TCAGAGGGAGGCTTAGGAATGGG + Intergenic
983032461 4:162820035-162820057 TTATTGGGATGATTAGAATTAGG - Intergenic
983299849 4:165911168-165911190 TGAGAGGGATGAATAGAGATTGG - Intronic
983428803 4:167621258-167621280 GCTCAGAGATGATAAGAAATTGG - Intergenic
983952718 4:173661599-173661621 ACAAAGAGATGATTTGAAATTGG + Intergenic
984693194 4:182752417-182752439 TCACAGGGTTGCTTAGTGATGGG - Intronic
986285617 5:6356199-6356221 TCACAGGGGTCCTTAGAAGTGGG - Intergenic
987560347 5:19511747-19511769 TCAAAGGGATGGTTTGAATTTGG + Intronic
988458342 5:31408811-31408833 TCACAGAGATTTTTAGAAATGGG + Intronic
990388430 5:55292155-55292177 TGACAGGGATGTAGAGAAATTGG - Intronic
990663654 5:58047545-58047567 TCAAAGGGGTGGTTAGAACTTGG + Intergenic
991687581 5:69195894-69195916 GCACAGTGATGATTAGATAATGG + Intronic
992337634 5:75789204-75789226 ACAAAGAGATGGTTAGAAATTGG + Intergenic
992489538 5:77228768-77228790 TCACAGGGAGGATTTTAAACAGG + Intronic
993256895 5:85603269-85603291 ACCCAGGGATGTTTATAAATTGG - Intergenic
993799821 5:92319174-92319196 ACAAAGAGATGATTTGAAATTGG + Intergenic
994006945 5:94848554-94848576 TCACAGGTATTATAAGAAGTAGG + Intronic
994560951 5:101371650-101371672 TCATAGGGAAAAATAGAAATAGG + Intergenic
995124128 5:108563279-108563301 TCACTGGGCTGTTTAGATATTGG + Intergenic
995831919 5:116362965-116362987 ACACTGGGAGGATTTGAAATGGG - Intronic
996650474 5:125870464-125870486 TCACTGTGATGACTAGACATAGG - Intergenic
997301235 5:132807083-132807105 TGAAAGGGATGATTAAAGATGGG + Intronic
997813760 5:136996769-136996791 TCACAGGGAGGATTGAAAAAAGG + Intronic
998166120 5:139845062-139845084 TCACAGGTATGATTAGGACCCGG - Intergenic
999163284 5:149523942-149523964 TCAGAGGGATGAAGAGAAGTAGG - Intronic
1000008293 5:157208198-157208220 GCACAAGGATCCTTAGAAATAGG + Intronic
1000859483 5:166439137-166439159 ACAAAGGGATGATTTGAAATGGG + Intergenic
1002827981 6:791016-791038 TCACAGGGAGGATTGAAAAAAGG - Intergenic
1002854003 6:1021712-1021734 TCACAGGGAAGATTGAAAAAAGG - Intergenic
1004356134 6:14931474-14931496 TCACAGGGGTGGTTAGAATTTGG + Intergenic
1004564650 6:16784736-16784758 CCAAAGGTATGATTAGAAATTGG + Intergenic
1004948473 6:20641643-20641665 TCACAGAGATTGTTACAAATTGG + Intronic
1006695463 6:35926888-35926910 TCACAGGAGTTATCAGAAATGGG + Intergenic
1007219538 6:40267692-40267714 TCAGAGGGGTGTTTAGAACTTGG - Intergenic
1008524414 6:52393867-52393889 TCACAGGGACCATTTGAGATGGG + Intronic
1011509666 6:88086714-88086736 TCAAACGGTTGATGAGAAATGGG - Intergenic
1011597486 6:89029921-89029943 TAAGAGAGATGATTAGAAATAGG - Intergenic
1011916345 6:92511159-92511181 TGAGAGAGATGATTTGAAATTGG + Intergenic
1013071704 6:106735496-106735518 TCAAAGGGATGGTTAGAGGTTGG + Intergenic
1013525357 6:110969016-110969038 TAACAGGAATGATTCAAAATGGG - Intergenic
1014302625 6:119701542-119701564 TCACAGGGATGTATAGAGAAGGG - Intergenic
1015272037 6:131346312-131346334 TCAAAGGGGTGGTTAGAACTTGG - Intergenic
1016466259 6:144328281-144328303 TCAAAGGGTTGGTTAGAACTGGG + Intronic
1016849057 6:148598250-148598272 TCAAAGGGGCGATTAGAACTTGG + Intergenic
1017216232 6:151910637-151910659 TGACAGGAATATTTAGAAATTGG - Intronic
1018535517 6:164814636-164814658 TTACAGAGATGATTTGAAATTGG - Intergenic
1020364357 7:7364562-7364584 TCAAAGGGGTGGTTAGAACTTGG - Intronic
1021462349 7:20902552-20902574 TCACAGGGGTCCTTATAAATGGG + Intergenic
1021617633 7:22519517-22519539 ACAAAGGGATGGTTTGAAATTGG + Intronic
1021640439 7:22730928-22730950 GCAAAGGGATGATTAGAAGTTGG + Intronic
1021819837 7:24485824-24485846 TAACAGGGGTGAGAAGAAATGGG + Intergenic
1022309689 7:29185170-29185192 TCATAAAGAAGATTAGAAATGGG - Intronic
1023264912 7:38394282-38394304 ACAGAGGGGAGATTAGAAATAGG - Intronic
1023274994 7:38509340-38509362 TGACAGGGATAGTTGGAAATTGG - Intronic
1023709406 7:42975846-42975868 ACAAAGAGATGATTTGAAATTGG - Intergenic
1024871295 7:53964302-53964324 TCAGAGGGGTGGTTAGAAACTGG + Intergenic
1028736641 7:94220516-94220538 TCACAGGAATGACTAGTGATGGG - Intergenic
1028778619 7:94708132-94708154 TCAAAGGGATGGTTAGCATTTGG + Intergenic
1028854540 7:95576062-95576084 TCAAAAGGATGCTTAGAACTTGG - Intergenic
1030903290 7:115150592-115150614 TCATAGAGAAGATTTGAAATAGG - Intergenic
1031745328 7:125489009-125489031 TCACAGTGCTGATTGGAATTTGG - Intergenic
1032148220 7:129403480-129403502 TCACAGGTAAGATTTGACATGGG + Exonic
1035747122 8:1970268-1970290 TGTCAGGGATGATGAGCAATGGG + Intergenic
1037462095 8:19121319-19121341 GCACAGGGAAAATTATAAATTGG - Intergenic
1037672237 8:21024926-21024948 TCACAGGGATAAAGAGAAAGGGG + Intergenic
1037750122 8:21676169-21676191 TCACAGGGAAGATATGAAGTAGG - Intergenic
1040091338 8:43401668-43401690 TCACAGGGATGGTCTGAAATTGG - Intergenic
1040797199 8:51299287-51299309 TCACAGGGAGGATTGAAAAAAGG - Intergenic
1041968982 8:63715068-63715090 TCACAAGGAAGAAAAGAAATGGG + Intergenic
1041979025 8:63834004-63834026 TTAAAGAGGTGATTAGAAATTGG + Intergenic
1041991556 8:63999160-63999182 TCACTGGAATTTTTAGAAATTGG + Intergenic
1042027445 8:64439095-64439117 TCAAAGGGGTGGTTAGAATTTGG + Intergenic
1043030641 8:75130196-75130218 ACAAAGAGATGATTTGAAATTGG + Intergenic
1043779517 8:84313477-84313499 ACAAAGAGATGATTTGAAATTGG - Intronic
1044041982 8:87381386-87381408 TGACAGGGATGTGGAGAAATTGG + Intronic
1045128712 8:99124056-99124078 GCACTGTGATGATAAGAAATTGG + Intronic
1046063859 8:109174051-109174073 ACAAAGAGATGATTTGAAATTGG + Intergenic
1046201955 8:110938710-110938732 TAACAGGTATGATTAGTATTAGG + Intergenic
1051637423 9:19193609-19193631 ACAAAGAGATGATTTGAAATTGG - Intergenic
1051664688 9:19457656-19457678 TCTCTGGGATGATTAGGAACTGG - Intergenic
1051876148 9:21795813-21795835 TCACAGGGATGATCAGAGGATGG + Intergenic
1052059126 9:23939078-23939100 TTAAAGGGATGATTAAAAACTGG + Intergenic
1052278980 9:26711267-26711289 ACACAGCAATGATGAGAAATTGG - Intergenic
1052540856 9:29810260-29810282 TGACAGAGATGATCTGAAATTGG + Intergenic
1053590439 9:39509043-39509065 TCACAGGGAGGATTGAAAAAAGG + Intergenic
1053624935 9:39859808-39859830 TCACAGGGAGGATTGAAAAAAGG - Intergenic
1053848298 9:42264441-42264463 TCACAGGGAGGATTGAAAAAAGG + Intergenic
1053879935 9:42583420-42583442 TCACAGGGAGGATTGAAAAAAGG + Intergenic
1054218962 9:62390890-62390912 TCACAGGGAGGATTGAAAAAAGG + Intergenic
1054231755 9:62518279-62518301 TCACAGGGAGGATTGAAAAAAGG - Intergenic
1054575862 9:66856246-66856268 TCACAGGGAGGATTGAAAAAAGG - Intergenic
1055123983 9:72697475-72697497 TCACAGGGATAGTTAGAAAAGGG + Intronic
1055414683 9:76068695-76068717 TTACAAAGATGATTACAAATGGG - Intronic
1055889507 9:81107858-81107880 TCAAAGGGGTGGTTAGAATTTGG + Intergenic
1055913756 9:81379449-81379471 TCAAAGGGGTGGTTAGAACTTGG - Intergenic
1057233230 9:93338123-93338145 TCACAGAGATGATTTGGAATTGG + Intronic
1057509377 9:95664965-95664987 TCACAGGGAGGATTGAAAAAAGG + Intergenic
1057526196 9:95804181-95804203 TCACAGGGAGGATTGAAAAAAGG + Intergenic
1059594514 9:115704151-115704173 TGACAGGGATGTGGAGAAATTGG + Intergenic
1062128668 9:134880729-134880751 TCACTCGGAAGATGAGAAATTGG + Intergenic
1185839158 X:3372523-3372545 TCACAGGGATCCTTACAAAAGGG + Intergenic
1185956217 X:4493746-4493768 CCAAAGGGAAGATTAAAAATAGG + Intergenic
1186513821 X:10151046-10151068 TCACAAGGATCATTATAAAAGGG - Intergenic
1186568951 X:10694372-10694394 TCAGAGGGGTGGTTAGAATTTGG - Intronic
1187075806 X:15933296-15933318 TCTCAGGGATGCTCAGGAATTGG - Intergenic
1187478196 X:19630406-19630428 TTACAGGTCTGATTAAAAATAGG + Intronic
1187572340 X:20517883-20517905 TGAGAGAGATGTTTAGAAATTGG + Intergenic
1187832721 X:23399221-23399243 TCACAGAGCTAATTAGAAACAGG + Exonic
1188605277 X:32021265-32021287 TCACAGAGAAGATTAGAGATGGG + Intronic
1189642626 X:43089177-43089199 TCACAGGTATCATTTGAAGTAGG - Intergenic
1193664166 X:84295784-84295806 TCACATGGATGTGGAGAAATGGG - Intergenic
1193930022 X:87542156-87542178 ACAAAGAGATGATTTGAAATTGG + Intronic
1194495932 X:94616512-94616534 TCAGAGAAATGATTTGAAATTGG - Intergenic
1194856084 X:98931515-98931537 TCACATGGATGTAGAGAAATTGG - Intergenic
1195637357 X:107133197-107133219 TAACAGGAATGATTCAAAATGGG - Intronic
1195662886 X:107398519-107398541 TCACTGGTAGGATTATAAATTGG - Intergenic
1195718551 X:107842890-107842912 TCAAAGAAATGATTAGTAATGGG + Intronic
1195737718 X:108031072-108031094 TCACTGGGATCATTAGAGCTGGG - Intergenic
1195873447 X:109512623-109512645 TGACAGAGATGAGGAGAAATTGG + Intergenic
1197427621 X:126317576-126317598 TTAAAGGGGTGGTTAGAAATTGG + Intergenic
1197741353 X:129896921-129896943 TCACATTGGTGATTTGAAATTGG - Intergenic
1198304719 X:135369000-135369022 TCACAGAGATGATTTAAAATAGG - Intergenic
1198587906 X:138143145-138143167 TCAAAGAGATGGTTAGAAGTTGG - Intergenic
1199306121 X:146269428-146269450 TGAGAGAGATGATTTGAAATTGG + Intergenic
1200901016 Y:8432151-8432173 TCAGAGGTATGATTATCAATTGG - Intergenic