ID: 1090795092

View in Genome Browser
Species Human (GRCh38)
Location 11:130128485-130128507
Sequence AAGTCAGTGCATCTTGTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090795092 Original CRISPR AAGTCAGTGCATCTTGTTCA GGG Intronic
902230270 1:15023187-15023209 AATTCAATGCAGCTTGTTCCTGG - Intronic
903620042 1:24691387-24691409 AAGTCAGTGGAGCTTTTTGAGGG + Intergenic
904312262 1:29636457-29636479 AGGTCAGTGCATTTAATTCAGGG - Intergenic
904354762 1:29931784-29931806 AAATCAGTGCTTCTTGTTTTAGG - Intergenic
905087534 1:35395138-35395160 AAGTCAGTGCTTCTGGTTCATGG + Intronic
908574097 1:65440947-65440969 AAATAAATGCATTTTGTTCAGGG + Intronic
909183912 1:72460924-72460946 AAGTCACTGAATCTGGTTCTAGG + Intergenic
912520127 1:110239467-110239489 CAGCCAGTGCATTTTCTTCATGG + Intronic
918392995 1:184085747-184085769 ATGTCAGTGCAGCTGGTCCATGG + Intergenic
918780306 1:188691232-188691254 AAGTCCTTTCATCTTGTTGAAGG - Intergenic
918947042 1:191079748-191079770 AAGGCATTTGATCTTGTTCATGG + Intergenic
921633921 1:217468997-217469019 AAGTCATTACAGCTTTTTCAAGG + Intronic
921722341 1:218487165-218487187 AAGTCTGTGCTTCTGGTCCAGGG + Intergenic
924372895 1:243373204-243373226 AAGTCAGAAGATCTGGTTCAAGG + Intronic
1066542393 10:36461330-36461352 AAGTAAGTACATCATGTTCCTGG - Intergenic
1068548765 10:58383475-58383497 AAGATAGTGGATTTTGTTCAGGG + Intergenic
1071543523 10:86509578-86509600 AAGTGAGTCCATCTTGTTCATGG + Intronic
1071896067 10:90068267-90068289 AATTCAGGGTCTCTTGTTCAGGG + Intergenic
1072415975 10:95247175-95247197 CAGTCAGAGGCTCTTGTTCAAGG - Intronic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1077542232 11:3152220-3152242 TAGTCAGTGGTTCGTGTTCATGG + Intronic
1079553425 11:21729864-21729886 AAGTCAGTCCTTCCTGCTCAGGG - Intergenic
1089441909 11:118524601-118524623 GGGCCACTGCATCTTGTTCATGG - Exonic
1090795092 11:130128485-130128507 AAGTCAGTGCATCTTGTTCAGGG + Intronic
1090967840 11:131614132-131614154 AAGTCTGTGCTTCTAGTTCAAGG - Intronic
1094268679 12:28587465-28587487 AGCTCAGTGCATCTTGTGGATGG + Intergenic
1094382759 12:29861188-29861210 ATTTCAGTTCATTTTGTTCATGG - Intergenic
1094568387 12:31620428-31620450 TAGTCATTGCATTTTTTTCAAGG - Intergenic
1095366454 12:41412189-41412211 ATGTCTGTGCACATTGTTCAAGG - Intronic
1096727449 12:53576133-53576155 AAGACTGTGCAACTTGTTTATGG + Intronic
1097619121 12:61918791-61918813 AATTCAGTGCCTCTGGTGCAGGG + Intronic
1099747868 12:86730368-86730390 AAGTCATATCATCTTTTTCAAGG + Intronic
1102581581 12:113891646-113891668 AAGTCAGTGAATTTTTTTTAAGG - Intronic
1104814945 12:131640220-131640242 CAATCAGAGCATCTTGATCAGGG - Intergenic
1106319356 13:28623869-28623891 AAGACACTGCATCTTTCTCAGGG - Intergenic
1106871563 13:34027383-34027405 AAGTCAGTGCAGCTTGGTGGAGG + Intergenic
1107664339 13:42673561-42673583 AAGGCAGTGCAACTGATTCAGGG - Intergenic
1107847915 13:44537091-44537113 CAGTAAGTGCATTTTTTTCATGG + Intronic
1108281140 13:48863461-48863483 AAGGCACTACATCTTATTCATGG - Intergenic
1108875020 13:55036547-55036569 AAGTCAGATAATATTGTTCAGGG + Intergenic
1110914257 13:81001767-81001789 AAGTCACTGCATTTCCTTCATGG + Intergenic
1114448564 14:22808971-22808993 CAGTCAGTGCACCTGGCTCAAGG + Intronic
1115020786 14:28678791-28678813 AATTTAGTGCATTTTGTTCAAGG - Intergenic
1115292477 14:31788088-31788110 AAGTCTGTGGTTCTTGTTCTTGG + Intronic
1116287451 14:42990814-42990836 ATGTCAGTTCATCATTTTCATGG + Intergenic
1116725984 14:48562039-48562061 ATGGGAGGGCATCTTGTTCATGG - Intergenic
1126870474 15:52981672-52981694 TAGGCAAAGCATCTTGTTCAAGG - Intergenic
1129866183 15:78910431-78910453 AAGTCAGTGTGTGTTGTTCTAGG - Intergenic
1131393560 15:92069064-92069086 AAATCAGTGCTTCTCATTCAAGG + Intronic
1134507059 16:14816530-14816552 AAGTGACAGCACCTTGTTCAAGG + Intronic
1134694759 16:16215271-16215293 AAGTGACAGCACCTTGTTCAAGG + Intronic
1134977073 16:18579365-18579387 AAGTGACAGCACCTTGTTCAAGG - Intergenic
1135066160 16:19311926-19311948 AAGCCAGTGCATCTTTCTTATGG - Intronic
1135105153 16:19643093-19643115 AATACAGTTCATCTTGTTGATGG - Intronic
1135146784 16:19969552-19969574 AAGGCAGGGCAATTTGTTCATGG + Intergenic
1141338260 16:83177898-83177920 AAGACTGTTTATCTTGTTCACGG + Intronic
1153879595 18:9409057-9409079 AAGGCTGAGCCTCTTGTTCAGGG - Intergenic
1155246480 18:23915151-23915173 AAGCCAGGGCATCTTGTTCCAGG + Intronic
1155352619 18:24921716-24921738 GAGACTGTGCATCTGGTTCAGGG - Intergenic
1160113213 18:76053540-76053562 AAGGCAGTCCATCTCGTTGATGG - Intergenic
1162130200 19:8521665-8521687 TGGTCTGTCCATCTTGTTCATGG + Intronic
1163047348 19:14653900-14653922 AAGTCAGTGCCTATTCTTCTTGG - Intronic
1165329017 19:35131255-35131277 AAGGCAGTGCTGCTTGCTCAGGG + Intronic
1165865127 19:38932378-38932400 CAGGCGGTGCATCTGGTTCAGGG - Exonic
925473708 2:4189755-4189777 AAGCCAGAGCCCCTTGTTCAAGG + Intergenic
926495106 2:13576392-13576414 AAGTCAGTGATTCTTGATAAAGG + Intergenic
927336428 2:21930055-21930077 AAGTCAGGGCATTTTGGCCATGG - Intergenic
928689011 2:33779644-33779666 AATTCTGTGCATAGTGTTCATGG + Intergenic
929773615 2:44913908-44913930 AGGTGAGTGCATTGTGTTCAGGG - Intergenic
930582209 2:53225888-53225910 AAGTGAGTGCTTCTTGTCCAGGG - Intergenic
934958310 2:98643916-98643938 AACTTACTGCATCTTTTTCAGGG + Exonic
936680162 2:114760616-114760638 AAGACAGTGCATCTTATATAAGG - Intronic
938214302 2:129496572-129496594 AGGTCATGGCATCTTGTCCATGG + Intergenic
940657283 2:156503183-156503205 AAGTCTCTGCCTCTTGTGCAAGG - Intronic
940770744 2:157836970-157836992 AAGTCTGTTCTTCCTGTTCATGG - Intronic
941124712 2:161571190-161571212 AAGGCAGTGGATGTTGTTCTAGG + Intronic
942510561 2:176695094-176695116 AAGACATTTCATCTTCTTCAGGG + Intergenic
944074360 2:195711519-195711541 AAGTCAGGGCATCTGCTTTATGG + Intronic
944338531 2:198566806-198566828 AAGTTAGTGCATGATGTTTAAGG + Intronic
945630799 2:212273806-212273828 AAGTGAGTGAACCTTTTTCATGG - Intronic
946720254 2:222598134-222598156 AAGAAAGTGCAACTTCTTCAGGG - Intronic
1169677004 20:8165685-8165707 AAGGCTGTGCATCTTGTCTAAGG + Intronic
1169721802 20:8685758-8685780 AAGTAATTGCTTTTTGTTCAAGG + Intronic
1171108052 20:22454861-22454883 AAATCTGTGCTTCTTATTCAAGG - Intergenic
1171131166 20:22653916-22653938 AGGGCTGTACATCTTGTTCACGG + Intergenic
1172607339 20:36222830-36222852 AAGTCACTGAATGTTGTTAAGGG + Intronic
1172978172 20:38921761-38921783 AAGTCATTGTTTCTTGCTCATGG + Exonic
1174533594 20:51233797-51233819 AGCTCAGTGCAGCTGGTTCATGG - Intergenic
1177672483 21:24251022-24251044 AATTTAGTGAATTTTGTTCAAGG + Intergenic
1179385312 21:40936406-40936428 ACTTCAGTTAATCTTGTTCATGG - Intergenic
1179829535 21:43987955-43987977 AAGTCAGTCCCTCTTGTTAGAGG - Intergenic
952110378 3:30116540-30116562 AAGAGAATGCATCGTGTTCATGG + Intergenic
954135137 3:48578970-48578992 AAGTCAGTTCATCATGGTCATGG + Intronic
955682712 3:61518923-61518945 AAGTCAGTTGGTCTTATTCAGGG + Intergenic
955838737 3:63088489-63088511 AAATCTCTGCATCTTGCTCATGG + Intergenic
955924349 3:63990858-63990880 AAGTGAGTGCCTGTTGTTCTTGG + Exonic
956216152 3:66851454-66851476 AAGCCAGTGCTTCTAGTCCAGGG + Intergenic
958587490 3:96108154-96108176 AAATCAGTACATTTTATTCAGGG + Intergenic
960990983 3:123311066-123311088 AAGTCAGTCCATGTTGTTCTGGG + Intronic
961826297 3:129600928-129600950 ATGTCAGTGCAGCATTTTCAAGG - Intronic
962945661 3:140166984-140167006 AAGACAAAGCATTTTGTTCAGGG + Intronic
963275306 3:143324190-143324212 AATTCAGTGGCTCTTGTTCAAGG - Intronic
965096286 3:164230881-164230903 AAGTCAGTGCTGGTTGTTGATGG - Intergenic
966532528 3:180996728-180996750 ATGTAAGTGCATCTTGTGCCTGG + Intergenic
967993213 3:195147071-195147093 AAGTCTATGTATCTTGTCCATGG + Intronic
971438000 4:26648417-26648439 ATGTCACTGCATCTTGGCCAAGG + Intronic
976331632 4:83838401-83838423 AAGTATGTGAGTCTTGTTCAGGG - Intergenic
979137821 4:117131104-117131126 AACGCAATGAATCTTGTTCATGG + Intergenic
982687364 4:158507130-158507152 AACTCTGTTCCTCTTGTTCAAGG - Intronic
986427888 5:7652842-7652864 AGGTCAGTGTGTCTTGGTCAGGG - Intronic
987374745 5:17223361-17223383 TATTCAGTGCATCTTTTTAAAGG + Intronic
989523499 5:42427161-42427183 AATCAAGGGCATCTTGTTCAAGG - Intronic
989988817 5:50736657-50736679 ATGTAAGTGATTCTTGTTCATGG - Intronic
991714714 5:69440737-69440759 AAATCAGTTCATCTTTTTGAAGG - Intronic
991908969 5:71542540-71542562 AGGTCAGTGCCCCTAGTTCAAGG - Intronic
993326366 5:86542827-86542849 AACTTAGTGCTTCTTTTTCATGG - Intergenic
993998733 5:94753026-94753048 AACCCAGAGGATCTTGTTCAGGG + Intronic
997867732 5:137479582-137479604 AATTCAGTGCATCTTCTTAGAGG - Intronic
998921669 5:147074940-147074962 AGGTCACTTCATCTTATTCATGG - Intronic
1001727522 5:173918625-173918647 AACTAAATGCATCTTGTGCATGG + Intronic
1003375141 6:5569763-5569785 AAGTCAGGGCATATTGTTATGGG + Intronic
1003733074 6:8847760-8847782 AAGTCTGTGCAATTTGCTCAGGG - Intergenic
1004382927 6:15148132-15148154 AAGTCAGGGCTTCTTATTCAGGG + Intergenic
1004458669 6:15815788-15815810 ATGTGAGTGCATGTTGTTAAAGG + Intergenic
1005282770 6:24292219-24292241 AAGACAGTGCATATTTTTTAAGG + Intronic
1011015201 6:82746678-82746700 AAGTCAGTCAACCTTGCTCAAGG - Intergenic
1011646933 6:89468623-89468645 AAGTCCGTGCATAATTTTCATGG + Intronic
1012382464 6:98636628-98636650 AAGTAAATGCATCATTTTCAGGG + Intergenic
1013986001 6:116194657-116194679 AAGTCAGTAGATGTTGTTTATGG + Intronic
1014892502 6:126859860-126859882 AAGTCAGTGCAACTCTTTCAAGG - Intergenic
1014948824 6:127530222-127530244 GAGTGAGTGCATCTGGTTGAGGG + Intronic
1017052403 6:150405847-150405869 AAGTCAGTATAACTTGCTCATGG - Intronic
1019451694 7:1101955-1101977 AAGGCACTGCAGCTTGTTCCTGG - Intronic
1020056277 7:5119478-5119500 AGTGAAGTGCATCTTGTTCAGGG - Intergenic
1021427761 7:20522070-20522092 AAGTCTGTGGTTCTTTTTCATGG + Intergenic
1025225959 7:57163434-57163456 AAGTCTGAGCATCTGCTTCAGGG + Intergenic
1028705649 7:93841960-93841982 CAGGCAATGCCTCTTGTTCATGG - Intronic
1029209454 7:98894153-98894175 AAGTCATTGTATGTTGTACAGGG + Intronic
1031505616 7:122578450-122578472 AAGTCAGTTCATGTAGATCAGGG + Intronic
1034893066 7:154857591-154857613 AACTCAGTGCATTTTGTTTGGGG - Intronic
1035226663 7:157437685-157437707 AAGCCAGTGCCTCATGGTCACGG + Intergenic
1038636604 8:29292536-29292558 GAGTCTCTGCATCTTCTTCAGGG - Intergenic
1040747070 8:50657339-50657361 ATGTCAGTGTATTTTGTTTATGG + Intronic
1040905643 8:52467364-52467386 TGGTCAGTGCTTCCTGTTCAGGG - Intergenic
1041704755 8:60834666-60834688 AAGTCAGTGTATTTTGTGGAAGG + Intronic
1044169518 8:89031751-89031773 AAGTTAGTTCATCATGATCAAGG + Intergenic
1045108481 8:98917130-98917152 AAACCAGTGCATCTAGGTCATGG + Intronic
1045587917 8:103560131-103560153 AAGTCAGTGCATCTTCTCACAGG + Intronic
1046088065 8:109463709-109463731 AAGGCTGAGCATCTTGTTTATGG - Intronic
1047573934 8:126132337-126132359 AAGGCAGTGAATCTTTTCCAAGG - Intergenic
1048132649 8:131714813-131714835 AAGACAGTCCCTCTTGCTCAAGG + Intergenic
1048984145 8:139723140-139723162 AAGTTAGTGTATCATGATCAAGG - Intergenic
1049859243 8:144886841-144886863 AAGACAGTTTATCTTGTCCATGG - Exonic
1055592938 9:77837066-77837088 AATTCAGTGGCTCTTCTTCAGGG + Intronic
1055944430 9:81680268-81680290 AAGTCAGAGCCTATAGTTCATGG + Intronic
1058072208 9:100612659-100612681 AAGACAGTGAATTGTGTTCATGG - Intergenic
1060399570 9:123340422-123340444 AAGCCATGGCATCTAGTTCAGGG - Intergenic
1188559908 X:31455814-31455836 AAGTTAGTGCATCTTTTGGAGGG + Intronic
1188817141 X:34729406-34729428 AAGTCAGCTCATCTTGTCCGAGG - Intergenic
1193587520 X:83343610-83343632 AACTCAGTGTATCTGGTTCTCGG + Intergenic
1195089401 X:101443874-101443896 AGGTCCTGGCATCTTGTTCATGG - Intronic
1195524117 X:105866034-105866056 AAGTCAGTACACTTTTTTCATGG + Intronic
1197387935 X:125823541-125823563 CTGTGAGTGCATCTTGTCCAAGG + Intergenic
1198437342 X:136630097-136630119 AAGTCTGTGCTTCTTGTGGATGG - Intergenic