ID: 1090795157

View in Genome Browser
Species Human (GRCh38)
Location 11:130129088-130129110
Sequence CACCAGCTGCTGCTTCTCAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 369}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090795157_1090795159 -10 Left 1090795157 11:130129088-130129110 CCAGTGAGAAGCAGCAGCTGGTG 0: 1
1: 0
2: 2
3: 40
4: 369
Right 1090795159 11:130129101-130129123 GCAGCTGGTGGAGACCCACCTGG 0: 1
1: 0
2: 3
3: 26
4: 289
1090795157_1090795166 25 Left 1090795157 11:130129088-130129110 CCAGTGAGAAGCAGCAGCTGGTG 0: 1
1: 0
2: 2
3: 40
4: 369
Right 1090795166 11:130129136-130129158 CTATGCTGAATGACCGCCGTCGG 0: 1
1: 0
2: 0
3: 1
4: 15
1090795157_1090795167 29 Left 1090795157 11:130129088-130129110 CCAGTGAGAAGCAGCAGCTGGTG 0: 1
1: 0
2: 2
3: 40
4: 369
Right 1090795167 11:130129140-130129162 GCTGAATGACCGCCGTCGGATGG 0: 1
1: 0
2: 0
3: 0
4: 14
1090795157_1090795160 -1 Left 1090795157 11:130129088-130129110 CCAGTGAGAAGCAGCAGCTGGTG 0: 1
1: 0
2: 2
3: 40
4: 369
Right 1090795160 11:130129110-130129132 GGAGACCCACCTGGCCCGAGTGG 0: 1
1: 0
2: 1
3: 14
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090795157 Original CRISPR CACCAGCTGCTGCTTCTCAC TGG (reversed) Exonic
900408583 1:2502971-2502993 CACCTGCTGCTGCTTCTGCGTGG + Intronic
900494443 1:2970126-2970148 CCACAGCAGCTGCTGCTCACAGG - Intergenic
900585584 1:3430919-3430941 CACGTCCTCCTGCTTCTCACTGG - Exonic
900619210 1:3579332-3579354 CACCAGCTCCTGCTTCAACCTGG + Intronic
901604733 1:10450242-10450264 CTCCTGCTGCTGCTGCTCTCCGG + Exonic
901849611 1:12007186-12007208 GACAAGCTGCAGCTTCTCGCTGG - Exonic
903813123 1:26045867-26045889 CAACAGATGCTGCTTCTCCTTGG + Exonic
904029205 1:27523497-27523519 GATCAGCTGCTGCTCCTCTCTGG - Intergenic
904249999 1:29216475-29216497 GAACAGCTGCTGCTAATCACAGG + Intronic
904613087 1:31735877-31735899 CCCCAGCTGCTGGCTCTCCCTGG - Exonic
904688464 1:32276427-32276449 CACCAGCTTCAGCGTCTCCCTGG - Exonic
905330864 1:37195747-37195769 CTCCAGCACCTGCTTCTGACAGG - Intergenic
905627814 1:39499821-39499843 CCCCAGCTGGTGTGTCTCACTGG + Intronic
905663387 1:39746011-39746033 CACCATTTGCTGCTCCTCAGAGG + Intronic
905791228 1:40790841-40790863 CCTCAGCTGCTTCTTCTCCCAGG + Intronic
905925572 1:41747078-41747100 ATCCTGCTGCTGCCTCTCACAGG - Intronic
906008937 1:42504446-42504468 CACCAGCTGGGGCTTCTCTTAGG + Intronic
906191344 1:43901363-43901385 CACCAGTTCCTACTTCCCACTGG + Intronic
906727614 1:48055361-48055383 TACCAGATGCTGCTTCTGACTGG - Intergenic
906857676 1:49325959-49325981 TAGCAGCTCCTGCTTCTCAGGGG - Intronic
907898393 1:58714898-58714920 CACCAGCTCCTGCTCCCCATTGG - Intergenic
907928036 1:58973060-58973082 CACCAGCTGATGCCTGTCCCAGG + Intergenic
910507704 1:87968854-87968876 CACCAGCTGCAGCTTCTGGGTGG + Intergenic
912384608 1:109265042-109265064 CAGTGGCTGCTGCTTCTCTCTGG + Intronic
915214327 1:154329813-154329835 CACCAGCAACTGCTTCTGACTGG - Intronic
915559042 1:156675955-156675977 TAACAGCTGCTCCTTCTCACAGG - Intronic
916440431 1:164819579-164819601 TCCCAGGTGCTGCTCCTCACAGG + Intronic
916802201 1:168226043-168226065 CACCAGCTCCAGCTCCTCAGCGG - Exonic
916822080 1:168409666-168409688 CTTTAGCTGCTGCTTCTCTCTGG + Intergenic
917738899 1:177944742-177944764 CACCAGCTGCAGCCTTTCATGGG + Intronic
918588427 1:186214255-186214277 TCCCAGCTGCTGCTTCTCCCGGG - Intergenic
919493690 1:198237437-198237459 CACCATCTTCTCCTTCTCAGTGG + Intronic
919767324 1:201135777-201135799 CAGCAGCTGCTGCATCCCTCGGG - Exonic
919929723 1:202213503-202213525 CAGCAGCTGCCGCTTCTCTCTGG - Intronic
920308588 1:205034556-205034578 CACAAGCTGTTGCTTCTTCCTGG - Intergenic
920308973 1:205037129-205037151 CACAAGCTGTTGCTTCTTCCTGG + Intergenic
920870533 1:209790685-209790707 GAACAGCTTCTGCTTCTCATTGG + Exonic
921351843 1:214243998-214244020 CAACCGCAGCTGCTTCTCAAAGG - Intergenic
921814762 1:219550835-219550857 TGCCAGCTGCTGCTTGTCAATGG + Intergenic
922729275 1:227941570-227941592 CCCCAGCTGCTGCTTCTTGCAGG - Intronic
923366661 1:233268383-233268405 CAGCAGCGGTTGATTCTCACTGG - Intronic
923758759 1:236819796-236819818 CGCCAGCTGTAGCTTCTCCCAGG - Intronic
924732498 1:246724565-246724587 CACCCGCTGCAGCTTCTCCCGGG - Exonic
924931949 1:248739942-248739964 CACCAGCTCTTGCTGGTCACCGG - Intronic
1062922331 10:1289629-1289651 CACCTCCTGCTTCCTCTCACTGG + Intronic
1063785378 10:9377786-9377808 CACAAGCTGCAGCTGCTCAGGGG - Intergenic
1064139986 10:12782225-12782247 AAACAGCTGCTGCTTCACCCAGG - Intronic
1064220842 10:13439364-13439386 CACGAGATGCTGCTCCTCCCAGG + Exonic
1065453179 10:25879999-25880021 CTCCAGCTGATGCTGCTCTCTGG - Intergenic
1066350004 10:34628513-34628535 CGACTGCAGCTGCTTCTCACTGG - Intronic
1066631740 10:37465192-37465214 CACCAGCCTCAGCTTCTCCCAGG - Intergenic
1067796377 10:49325076-49325098 CACCATCTTCTGCTTCAAACAGG + Exonic
1068587612 10:58816824-58816846 CACCAGCGCTTGCTTGTCACTGG + Intronic
1069583065 10:69578232-69578254 GAGCAGCTGCTCCTTCTCGCGGG - Intergenic
1069622512 10:69846503-69846525 CACCAGCTGAGCCTTCTCCCTGG - Intronic
1070140614 10:73734704-73734726 GAGCAGGTGCTGCTTCGCACAGG + Intergenic
1070556518 10:77532127-77532149 CCCCAGTTGCTGCTTCTCGTAGG - Intronic
1072646686 10:97261064-97261086 CACAAGCTGCTCCTTATAACAGG + Intronic
1076232816 10:128835680-128835702 CAGCATCTCCTGCTGCTCACAGG + Intergenic
1076312018 10:129515264-129515286 CCGCAGCTGCTGCTCCTGACGGG - Intronic
1076441627 10:130484629-130484651 CTCCAGCTCCTGTTCCTCACAGG - Intergenic
1076771627 10:132669272-132669294 CACAAGCTGGTGCTACTCACCGG - Intronic
1077584746 11:3442635-3442657 CAAGAGCTGGTGCTTCTTACAGG + Intergenic
1078077802 11:8177363-8177385 CAACAGCTGCTGCCGCTCAAAGG + Intergenic
1079104573 11:17561912-17561934 CACCTGCTGCCTCTTCTCTCTGG + Intronic
1082089751 11:48079670-48079692 ACCCAGCTGCAGCTTCTCAAGGG + Intronic
1082261407 11:50078307-50078329 CCCCAGCTCCTGCCTCTCATCGG - Intergenic
1082964012 11:58947311-58947333 CAAGAGCTGCTGCTTCTCTTTGG + Intronic
1083549321 11:63574497-63574519 CTCCAGCTGCTGAGTCTCAGAGG + Exonic
1083841713 11:65308588-65308610 CTCCAGCTGCTGCCTCTGCCTGG - Intergenic
1083898759 11:65633602-65633624 CACCAGCTCCTGCTGCTACCTGG + Intronic
1083899200 11:65635560-65635582 CACCAGCTCCTGCTGCTGCCCGG - Exonic
1084365146 11:68692899-68692921 CTGCCGCTGCTGCTGCTCACTGG + Intergenic
1084556540 11:69879360-69879382 CAGCAGCTGCCGCTTCTTGCAGG + Intergenic
1084830689 11:71766654-71766676 CAAGAGCTGGTGCTTCTTACAGG - Intergenic
1084864579 11:72045294-72045316 CATCACCTGCTGCTTCTTCCAGG + Intronic
1085319604 11:75565811-75565833 CAGCTGCTGCTTTTTCTCACTGG + Intronic
1085389533 11:76175473-76175495 CACCAGCATCTGGTGCTCACAGG - Intergenic
1086337191 11:85811337-85811359 CCCCGCCTGCTGCTTCTCTCCGG + Intergenic
1087216776 11:95503365-95503387 CACCAGCTGTTTCTTCTGTCTGG + Intergenic
1087216855 11:95504049-95504071 CACCAGCTGTTTCTTCTGTCTGG - Intergenic
1088433381 11:109783029-109783051 CATCAGCCCCTGCTTCCCACAGG + Intergenic
1089229427 11:116958854-116958876 CATCTGCTCCTGCTTCTCTCAGG + Intronic
1089497117 11:118913538-118913560 CCCCAGCTGCTCCCTCCCACAGG + Intronic
1089500373 11:118928509-118928531 CTCCAGCTGGTACTCCTCACCGG + Intronic
1090795157 11:130129088-130129110 CACCAGCTGCTGCTTCTCACTGG - Exonic
1091567496 12:1659873-1659895 ACCCAGCTGCTTCTCCTCACTGG + Intergenic
1092285222 12:7124698-7124720 CACCAGGTGCTCCTCCTCCCAGG + Exonic
1095970774 12:47900779-47900801 GAGAAGCTGCTGCCTCTCACTGG - Intronic
1096091430 12:48904374-48904396 CAGAAGCAGCTGCTTCTCATCGG - Exonic
1097048619 12:56206510-56206532 CCCCATGTGCTGGTTCTCACAGG + Exonic
1097392690 12:59034832-59034854 CACCTGCTGCTGATGCCCACAGG - Intergenic
1099004880 12:77224329-77224351 CACTTGCTGCTGCCTCCCACTGG - Intergenic
1100449921 12:94696058-94696080 CCCCTGCTGCTGCTCCTCAGGGG - Intergenic
1101449025 12:104759627-104759649 CAGCAGCTGCAACATCTCACCGG + Exonic
1101698592 12:107150710-107150732 CACCATCAGCTGCTACTCTCTGG - Intergenic
1103570245 12:121839915-121839937 CACCAGGTACTGCTTGTCCCCGG - Exonic
1103736070 12:123061633-123061655 CACAAGATGATGCGTCTCACAGG + Intronic
1105936106 13:25100886-25100908 AACAAGCAGCTGCTTCTCAGAGG - Intergenic
1106765124 13:32906047-32906069 CAGCTGCTGCTGTTTCTCTCTGG + Intergenic
1107145628 13:37058017-37058039 CACCCGCTTCTGCCTCTTACAGG - Intronic
1107283324 13:38761702-38761724 CAGCTGCAGCTGCTTCACACAGG + Intronic
1110758603 13:79205080-79205102 CACCAGCATCTGCTTCTGGCAGG + Intergenic
1111919524 13:94395954-94395976 CTCCAGCTGCTGCCTCCCATTGG - Intronic
1113338575 13:109400384-109400406 CACCAGCTACTGCTTCCTCCTGG + Intergenic
1113607933 13:111623586-111623608 CTCCTGCTGCTGCTGCTCAGAGG - Intronic
1113777535 13:112956656-112956678 CAGCAGCAGCTGCTCCACACAGG - Intronic
1117254041 14:53960388-53960410 CACCAGCTGCTGCTCCATCCTGG + Intergenic
1117813043 14:59568756-59568778 CACCAGCTCCTGTCTATCACTGG - Intronic
1119423129 14:74519805-74519827 CAGCAGCTGCTGCTTATCCCAGG + Intronic
1119485179 14:74982165-74982187 CACGTCCTGCTGCTTCTCCCAGG - Intergenic
1119985695 14:79134573-79134595 AAGCAGCTGCTGCTTCTCTATGG - Intronic
1120341453 14:83225792-83225814 CACCCGCTGCTGCTCCTGATGGG + Intergenic
1120451413 14:84671928-84671950 CTCCATCTGCTGCTATTCACAGG - Intergenic
1121011278 14:90521633-90521655 CACCAGCTGGAGCCTCTTACAGG + Intergenic
1121571439 14:94949589-94949611 CCCCAGCTGCTGGTGGTCACTGG + Intergenic
1121571984 14:94953078-94953100 CCCCAGCTGCTGGTGGTCACTGG + Intergenic
1122156164 14:99751691-99751713 CACCAGCTGCCTCTTCTGCCAGG - Intronic
1122272221 14:100573393-100573415 CCCCAGCTGCTCCTTCCCACTGG - Intronic
1122739239 14:103861653-103861675 CAACAGCAGCATCTTCTCACTGG + Intergenic
1123056813 14:105574720-105574742 CACCAGCAGCAGCTCCTCATGGG + Intergenic
1123081397 14:105697065-105697087 CACCAGCAGCAGCTCCTCATGGG - Intergenic
1123830945 15:24136587-24136609 CTTCAGCTGCTGGTGCTCACAGG + Intergenic
1123836024 15:24193962-24193984 CTTCAGCTGCTGGTGCTCACAGG + Intergenic
1124214757 15:27797130-27797152 CACCAGCAGCTGCTCCTCAAAGG - Intronic
1127400943 15:58585264-58585286 CCCCAGCAGCTGCTTTTCTCAGG + Intergenic
1127500362 15:59549019-59549041 CACCAGCAGCTGCTACTCCCAGG + Intergenic
1128482125 15:68048294-68048316 CACCAGCCCCTTCTTCTCCCTGG + Intergenic
1128554743 15:68623694-68623716 CACCCGCTGCTGCTGCTCCTGGG - Intronic
1128628102 15:69232649-69232671 AACTAGCTGCGGCTTCTTACAGG + Intronic
1128670650 15:69572526-69572548 CATGAGCTGGTGTTTCTCACGGG - Intergenic
1129034187 15:72639852-72639874 CCCCAGCTGCTGCAGTTCACTGG - Intergenic
1129215695 15:74097364-74097386 CCCCAGCTGCTGCAGTTCACTGG + Intergenic
1129409107 15:75339072-75339094 CCCCAGCTGCTGCAGTTCACTGG - Exonic
1129732830 15:77941692-77941714 CCCCAGCTGCTGCAGTTCACTGG + Intergenic
1130959991 15:88652932-88652954 CACCAGCTGCTGCTGCTCCTGGG + Intronic
1131454567 15:92573019-92573041 CACAATCTCCTTCTTCTCACCGG + Intergenic
1131461778 15:92622678-92622700 CACCTGCTGTTACTTCTCCCTGG + Intronic
1131568218 15:93505806-93505828 CTCCAGCTGCAGGTTCACACAGG - Intergenic
1131766754 15:95684826-95684848 CACCATCTGCTTCTTATCTCAGG + Intergenic
1131880700 15:96859129-96859151 CACGAGCTGCTGCTTGACAGTGG - Intergenic
1131904733 15:97130854-97130876 CACCTGATTCTGCTTTTCACAGG - Intergenic
1132176152 15:99716803-99716825 CTCCAGTAACTGCTTCTCACAGG + Intronic
1132405062 15:101536913-101536935 CCCCATCTGCTGCTGCCCACAGG + Intergenic
1132606539 16:795969-795991 GGCCAGCTGTTGCTTTTCACGGG - Exonic
1134266720 16:12699246-12699268 TAACAGGTGCTGCTTCACACTGG + Intronic
1135495813 16:22950221-22950243 GACCAGCTTCTCCTTCTCACTGG + Intergenic
1136384111 16:29911975-29911997 CAGGAGCTGCTGCTCCTCCCGGG + Exonic
1138285900 16:55810091-55810113 CACCAGCTTCTACTTGTCATTGG - Intronic
1138651679 16:58464446-58464468 CACCGGCTGGAGCTGCTCACAGG + Exonic
1140040547 16:71404699-71404721 CACCAGCTCCTGTCTCTCATTGG - Intergenic
1141532713 16:84657854-84657876 CGCCGGCGGCAGCTTCTCACGGG + Exonic
1142369516 16:89670310-89670332 AACGGGCTGCGGCTTCTCACAGG - Exonic
1142504364 17:353451-353473 CACCTGCTGCTGCTCCCCATGGG - Intronic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1143688762 17:8542224-8542246 CAGCTGCTGCAGCTTCTCATTGG + Exonic
1143854629 17:9839552-9839574 CACCCTCTGCTGCTTCTCCATGG + Intronic
1144275080 17:13658822-13658844 TTTCAGCTGCTGCTTCTCACAGG + Intergenic
1144630210 17:16867711-16867733 CCCCAGCTCCTGCTTGTTACAGG - Intergenic
1144706485 17:17371723-17371745 CACAAGCTGATGCTTCTACCTGG + Intergenic
1146647817 17:34586952-34586974 AACCAGCTGCTCATTCTCACAGG - Intronic
1147166905 17:38598343-38598365 CACCAGCCTCTGCTTCTTATGGG - Intronic
1147997131 17:44366372-44366394 CACCAGTTGGTGATTCTCAGTGG + Intergenic
1150820283 17:68429183-68429205 CACTAGCTATTGCTTCTCGCAGG - Intronic
1150828258 17:68495480-68495502 CACCAGCTCCTCCATCTCCCTGG + Intergenic
1151308624 17:73279959-73279981 CGGCAGCTGCTGCTTCCCATAGG - Intergenic
1151704330 17:75758654-75758676 CACCGCCTGCTGGTCCTCACAGG - Intronic
1151905436 17:77045421-77045443 CATCATCTGCTGGTTTTCACTGG - Intergenic
1152026306 17:77811667-77811689 CTTCAGCTGCTGCGTCTCAGGGG - Intergenic
1152112836 17:78366528-78366550 CACCAGCTCCTGCCTCTCCAAGG - Intergenic
1152118500 17:78403686-78403708 CAGCAGCTGCTGCATCTTCCTGG - Exonic
1152191962 17:78893709-78893731 CACCAGCTTCTCCTCCTCTCTGG - Intronic
1152635915 17:81430439-81430461 CACCAGCGGCCACTTCTCACTGG + Intronic
1152845457 17:82597010-82597032 CACCAGCCCCTGCCCCTCACCGG - Intronic
1152879137 17:82805445-82805467 CACCAGGTGCTGCGTCTCACCGG - Intronic
1153604434 18:6817603-6817625 CACCAGATGCTGCCTATCTCTGG - Intronic
1155283563 18:24265873-24265895 CACCACCTACTGCTTCCCATCGG + Intronic
1156129751 18:33957025-33957047 AACGAGATGCTGGTTCTCACTGG + Intronic
1156136683 18:34048606-34048628 CACCATCTCCTGCTTCATACAGG - Intronic
1156204173 18:34867840-34867862 CAGCAGCTTCTGCATCTCAGGGG + Intronic
1157204499 18:45687184-45687206 GCACAGCTGCTGCTTCTCACTGG - Intergenic
1158183500 18:54744908-54744930 CACCAGCAGAAGCTTCTCCCAGG - Intronic
1158945592 18:62444526-62444548 CCCCAGAAGCTGCTTCTCCCTGG - Intergenic
1159840472 18:73393336-73393358 CCCCAGTTACTGCTTCTCTCTGG - Intergenic
1160022709 18:75192804-75192826 CTCCTGCTGCCGCTGCTCACAGG + Intergenic
1162334618 19:10052810-10052832 CAGCAGCTGCTGAATCTCACTGG - Intergenic
1162452175 19:10761817-10761839 CATCGGCTGCTGTCTCTCACTGG - Intronic
1162805566 19:13136379-13136401 CACCAGCTCCAGCTTCTCAGAGG - Exonic
1162956381 19:14100908-14100930 GACCAGCCACTGCTTCCCACAGG - Exonic
1163220563 19:15915537-15915559 CACCTGCTTCTTCTCCTCACAGG + Intronic
1163294956 19:16405985-16406007 CAGCTGCTGCTGCCTCTCCCTGG - Intronic
1163653096 19:18530191-18530213 CTCCAGCTGTGCCTTCTCACAGG + Intergenic
1164822940 19:31264233-31264255 CACCACCTCCTGCCTGTCACTGG - Intergenic
1165097917 19:33419833-33419855 CCCCAGCTCCTGCTTTCCACCGG - Intronic
1165326028 19:35115223-35115245 TCCCAGCAGCTGCTTCTCCCTGG + Intergenic
1166775849 19:45311991-45312013 CCCCTGCTGCTGCTCCTAACGGG + Intronic
1166843647 19:45713258-45713280 CACCAGCAGCTGCTGCTGAGAGG + Exonic
1167009285 19:46796263-46796285 CACCAGCTGCTGGGTCCCTCAGG - Intergenic
925111514 2:1342287-1342309 CAGCAGCAGCTTCCTCTCACTGG + Intronic
925111594 2:1342742-1342764 CAGCAGCAGCTTCCTCTCACTGG + Intronic
925111633 2:1342970-1342992 CAGCAGCAGCTTCCTCTCACTGG + Intronic
925111713 2:1343425-1343447 CAGCAGCAGCTTCCTCTCACTGG + Intronic
925111752 2:1343652-1343674 CAGCAGCAGCTTCCTCTCACTGG + Intronic
925111771 2:1343765-1343787 CAGCAGCAGCTTCCTCTCACTGG + Intronic
925111789 2:1343878-1343900 CAGCAGCAGCTTCCTCTCACTGG + Intronic
925111808 2:1343991-1344013 CAGCAGCAGCTTCCTCTCACTGG + Intronic
925111847 2:1344218-1344240 CAGCAGCAGCTTCCTCTCACTGG + Intronic
925111885 2:1344444-1344466 CAGCAGCAGCTTCCTCTCACTGG + Intronic
925111903 2:1344557-1344579 CAGCAGCAGCTTCCTCTCACTGG + Intronic
925111922 2:1344670-1344692 CAGCAGCAGCTTCCTCTCACTGG + Intronic
925111981 2:1345011-1345033 CAGCAGCAGCTTCCTCTCACTGG + Intronic
925112019 2:1345238-1345260 CAGCAGCAGCTTCCTCTCACTGG + Intronic
925112039 2:1345351-1345373 CAGCAGCAGCTTCCTCTCACTGG + Intronic
925112120 2:1345805-1345827 CAGCAGCAGCTTCCTCTCACTGG + Intronic
925112140 2:1345918-1345940 CAGCAGCAGCTTCCTCTCACTGG + Intronic
925206925 2:2014854-2014876 CTCTAGCTTCTGCTTCTCATGGG - Intronic
925426324 2:3751502-3751524 GACAAGCTGCTGCTTCTCCTGGG - Intronic
926225081 2:10961505-10961527 CTCCAGCTGCTGCCTCTGTCTGG + Intergenic
926365081 2:12125647-12125669 CACCAGGTGCTTCTCCACACAGG + Intergenic
926971659 2:18472930-18472952 CACCAGCACTTGCTTCTCTCAGG + Intergenic
928407330 2:31024507-31024529 CACCTGCTGCTCCTTCTACCTGG + Intronic
929327859 2:40639447-40639469 GACCAGCTGCTGATACTCAAGGG - Intergenic
929835649 2:45395008-45395030 CAGCAGCTGTTCCTTGTCACCGG - Intronic
930789265 2:55307006-55307028 ATGCAGCTGCTGCTTCTCCCAGG - Intronic
931231202 2:60376242-60376264 CATCAGCAGCTGATTCTCCCTGG + Intergenic
931244932 2:60484594-60484616 CACCAGGTGCGGCTGCTGACCGG - Intronic
931456292 2:62411960-62411982 CACCAGCTTCCTCTTCTCTCTGG - Intergenic
933436871 2:82260206-82260228 CACCAGCTGCAGATTCTCTCAGG + Intergenic
934102532 2:88666682-88666704 CCCCAACTGCTGCTCCTCTCAGG + Intergenic
934750153 2:96788869-96788891 CTCCAGCTGCTTTTTCTCATGGG - Intronic
934936793 2:98471548-98471570 GCCATGCTGCTGCTTCTCACAGG + Intronic
935277312 2:101486079-101486101 CACAAGCTGCTGTTTCTGTCTGG + Intergenic
935878746 2:107539843-107539865 CACCAGCTGCTGATTTGCACTGG - Intergenic
935933405 2:108154561-108154583 CACCGGATGCTGCGCCTCACAGG - Intergenic
936094830 2:109523647-109523669 TGCCAGCAGCTGCTTCTCAGCGG - Intergenic
938256190 2:129861722-129861744 CTGCAGCAGCTGCTACTCACTGG - Intergenic
942558858 2:177199555-177199577 CTCTACCTGCTGCTACTCACCGG + Intergenic
943131993 2:183865337-183865359 TACCAGCTGCTGCTGTTCTCTGG - Intergenic
943152988 2:184138083-184138105 CACCAGCTGAAGCATTTCACAGG + Intergenic
944288424 2:197977336-197977358 CACCAGCTGCTGCATTTCCAGGG + Intronic
948612500 2:239178851-239178873 CACCAGCTGGTGATTCTTCCTGG + Intronic
949051802 2:241901685-241901707 AAGCAGCTGCTGGTTCTCACCGG - Intronic
1169498085 20:6133729-6133751 CACCAACTGCTGTATCTCATTGG - Intergenic
1169847381 20:10009161-10009183 CACCAGTTCCAGTTTCTCACTGG + Intronic
1170408848 20:16067079-16067101 CACCAGGTGCTGCTGCTCTGTGG + Intergenic
1171187955 20:23136932-23136954 CAGCTGCTGCTGCTTCTCACTGG - Intergenic
1171330383 20:24332251-24332273 CACTGGCTGCTGGTTCTCATTGG - Intergenic
1171369838 20:24654783-24654805 CTGCAGCTGCTCCTTCTCTCTGG - Intronic
1172189783 20:33054950-33054972 TTCCAGCAGCTGCTTCCCACTGG - Intergenic
1172779223 20:37425942-37425964 CACCTTCTGCACCTTCTCACTGG + Intergenic
1173555446 20:43962272-43962294 CACCAGCTGCAGCTGCCCAGAGG - Intronic
1173619915 20:44429152-44429174 CAACTGCTGCTCCTTCTCCCAGG + Intronic
1174279942 20:49432071-49432093 CACCAGCTGCTGTTGATCACGGG - Intronic
1174435679 20:50505136-50505158 CACCAGCTGTTCCTTCTGCCTGG - Intergenic
1175040996 20:56050425-56050447 CCACAGCTGCCGCTTCTCCCAGG - Intergenic
1175069827 20:56323999-56324021 CTCCAGCTGCTGCCTCCCATTGG - Intergenic
1176193984 20:63828594-63828616 CTCAGGCTGCTGCTTCTCCCTGG - Intronic
1176266794 20:64213578-64213600 CTGCGGCTGCTGCTTCTCATGGG - Exonic
1177815816 21:25975166-25975188 CACCAGCTGCTGTCTCTCGTTGG + Exonic
1178409076 21:32348979-32349001 CAGCAGGTGCTGCTTTTCACAGG - Intronic
1178958770 21:37045291-37045313 CCCCAGCTGCTGCTGCTGATAGG - Intergenic
1179299093 21:40090447-40090469 CACCCACTGATGCTGCTCACAGG + Intronic
1181465669 22:23109388-23109410 GATCAGCTGCTGCTCCTCTCAGG + Intronic
1182350326 22:29695703-29695725 CCACAGGTGCTGCTTCTCACTGG + Exonic
1182452086 22:30427688-30427710 CACCTGCTCCTGCTTCTCTCTGG - Intronic
1183187458 22:36300208-36300230 CTCCAGCTGCAGCTTCTGCCGGG + Exonic
1183476623 22:38039194-38039216 CCCCATCTGGTGCTTCCCACGGG - Intronic
1184892471 22:47388471-47388493 CAACAGCTGCTTCTTCACATGGG - Intergenic
1185359940 22:50400093-50400115 GACCCACTGCTGCTTCCCACTGG - Intronic
949950915 3:9228133-9228155 CACCTGCTGCTGCTTGTCATTGG - Intronic
950392687 3:12709032-12709054 CACCCAGTGCTGCTTCCCACAGG - Intergenic
952065622 3:29566334-29566356 CACCTGCTGTTGCTTTTGACTGG - Intronic
953419348 3:42742494-42742516 CACCAGGGGCCGCATCTCACTGG - Intronic
954263943 3:49459266-49459288 CAACAGCTGCTGCTGTTCCCAGG - Intergenic
954719752 3:52551327-52551349 CATCAGCAGCTGGTTCTAACTGG + Intronic
954812089 3:53254942-53254964 CACCAGGTGCTGTATCTCCCAGG - Intronic
956167269 3:66406103-66406125 TTCCTGCTGCAGCTTCTCACAGG - Intronic
956961193 3:74403078-74403100 CTTCAGCAGCTGCTTTTCACAGG - Intronic
958054286 3:88389327-88389349 CACCTGCTGCTCCTTCTTCCAGG - Intergenic
959159671 3:102708101-102708123 GACAAGCTGCAGCTTCTGACTGG - Intergenic
960715046 3:120566810-120566832 CACCAGCTGACCCTGCTCACTGG + Intergenic
960963666 3:123090028-123090050 CACTGGCTGCTGCTTCTCCAGGG - Intronic
961171697 3:124801879-124801901 CACCATCAGCTGCTTTCCACTGG + Intronic
961225825 3:125244908-125244930 CTCCAACTGCTCCTTCTCAGTGG + Intronic
961251031 3:125505621-125505643 CACCAACTGCTTCTTCTAAGAGG + Intronic
962316303 3:134361569-134361591 CAGCTGCTCCCGCTTCTCACAGG + Exonic
963936121 3:151055374-151055396 CACCAGATGCTGGCTCACACAGG - Intergenic
964058892 3:152496418-152496440 TACCAGCTGCTGCATTCCACAGG - Intergenic
964077971 3:152714768-152714790 CACCAGCTGGTCCTTCTTCCTGG + Intergenic
966923878 3:184631939-184631961 CACCAGCTGCTGGGTGCCACAGG + Intronic
967852045 3:194089647-194089669 CGCTAGCTGCCTCTTCTCACTGG + Intergenic
968547869 4:1207877-1207899 CACCAGGTGCTGGTGCTCAGAGG + Intronic
968762455 4:2449695-2449717 CTCCAGCTGCTGCTGCTCCTTGG - Exonic
968888259 4:3348788-3348810 AAGCAGCTGCAGCTTCTCAAGGG + Intronic
969094359 4:4720738-4720760 GACCAGCTGCCTCTTCTCACTGG + Intergenic
969203493 4:5624148-5624170 CACCAACTGCTTTTTCTCCCAGG - Intronic
969754076 4:9136159-9136181 CAAGAGCTGGTGCTTCTTACAGG - Intergenic
969891947 4:10268145-10268167 CATCACCTGCTGCTTTTCATTGG + Intergenic
970492602 4:16590120-16590142 CACTAGCGGCGGCTTCTCAGGGG + Intronic
971132128 4:23823497-23823519 CACCAATTGCTGGTCCTCACTGG + Intronic
971267954 4:25111315-25111337 CACAAGCTTCTGCTTCTGAAAGG + Intergenic
971868744 4:32208182-32208204 CTCCACCTAGTGCTTCTCACTGG - Intergenic
972917651 4:43901260-43901282 CATCAGCTCCTGTTTCTCATTGG + Intergenic
976842754 4:89451104-89451126 CACCAACTGCTGCCTCTGCCTGG - Intergenic
976955215 4:90888235-90888257 CCCCATGTGCTGTTTCTCACTGG - Intronic
979050331 4:115921816-115921838 CACCAGCTACCGCTGCCCACTGG + Intergenic
981546849 4:145902634-145902656 CACCACCTGCAGCTTGTCTCCGG - Exonic
981565194 4:146093861-146093883 CACCACCTCCTGCTTGACACTGG - Intergenic
981908568 4:149952410-149952432 CTCCAGCTGCTGGTTCACTCTGG + Intergenic
983143219 4:164179159-164179181 CACCAGCTCCTTCTGCTCCCTGG - Intronic
986313001 5:6568529-6568551 CACGAGCTGCTCCATCTCACTGG + Intergenic
987740827 5:21907005-21907027 CAGTCGCTGCTGCTTTTCACAGG - Intronic
988093979 5:26578916-26578938 TACCAGTGGCTGCTTCTCACTGG - Intergenic
990937578 5:61166690-61166712 CACCTGCTTCTGCTTCACAAAGG - Intergenic
991035290 5:62122338-62122360 CACCAGCTCCTGTCTCTTACGGG - Intergenic
992347454 5:75894459-75894481 GTCCAGCTGCTGGTTTTCACTGG - Intergenic
993901222 5:93585133-93585155 CGCCTGCTGCTGCTGCTCGCCGG - Exonic
996533401 5:124550079-124550101 CAGCAGCAGCTCCTTCTCATAGG + Intergenic
997293126 5:132752080-132752102 CACCAGCTGCTGCAGTTCAAGGG + Exonic
997453050 5:133998915-133998937 CCTGAGCTGCTGCTTCTCAGTGG - Intronic
997758957 5:136426204-136426226 CACATGCTGCTGCTTCTCTCTGG + Intergenic
997759460 5:136431212-136431234 CACATGCTGCTGCTTCTCTCTGG + Intergenic
998323059 5:141250754-141250776 CACCAGCTGCTACTTCCTGCAGG - Intergenic
998561728 5:143178640-143178662 CAACAGCTGCTGCTGCCCATGGG + Intronic
998569287 5:143243092-143243114 CACTGGCTTCTGCTTCACACAGG - Intergenic
998856609 5:146400474-146400496 CAGCATCTGCTGCATCTCAGAGG - Intergenic
999013949 5:148076097-148076119 CTCCAGCATTTGCTTCTCACTGG - Intronic
999039965 5:148398030-148398052 CTCCAGCTGGTGCATCTCATTGG + Intronic
999589811 5:153132527-153132549 CAGCAGGTTCTGCTTCTCTCTGG + Intergenic
1000744323 5:165013548-165013570 CACTAGTTGCAGCTTCTCCCTGG - Intergenic
1002287976 5:178177939-178177961 CACGAGCGGCTGGTGCTCACAGG + Intergenic
1002442969 5:179273906-179273928 CACCACCCCATGCTTCTCACTGG + Intronic
1003267198 6:4576177-4576199 CCCCAGATGCTTCTTCTCCCTGG + Intergenic
1006002450 6:30976073-30976095 CACCAACCGCTCCTTCCCACAGG + Intergenic
1006871335 6:37254987-37255009 CAGCAGCAGCAGATTCTCACAGG - Intronic
1007985487 6:46203554-46203576 CACCAGCTGTTGCTGCTCAGAGG - Intergenic
1012381707 6:98627552-98627574 CTGCAGCTGCTGCTTTTCAATGG + Intergenic
1013836311 6:114340876-114340898 AAACAGCTGGTGCTTCTCAAAGG - Intronic
1016326381 6:142907324-142907346 AACCAGCTGCTGCTTTCCCCGGG + Intronic
1017014418 6:150088747-150088769 CACCAGTTCCTGCTTCTCAAAGG + Intergenic
1017042992 6:150322789-150322811 CACCAGCTGCTGCTGCTTGCAGG - Intergenic
1017592556 6:155993093-155993115 CACCATCTTCTGCTTCACATAGG - Intergenic
1018254022 6:161900302-161900324 CTGCTGCTGCTGCTTCTCAGTGG - Intronic
1018379610 6:163246324-163246346 CACCAGCTCCTTCTTCTGCCTGG + Intronic
1018472882 6:164112178-164112200 CCCTAGCTGCCCCTTCTCACTGG - Intergenic
1018722500 6:166583442-166583464 CACCAGCTGCTTCTTCCCATTGG - Intronic
1019192742 6:170262704-170262726 CAGCGGCTGCTGCTCCTGACGGG - Intergenic
1019377141 7:698906-698928 CACCAGCTGCTGCTGCTGCGTGG - Intronic
1019508109 7:1403599-1403621 CCCCAGCTGCGGCTGCTCCCTGG + Intergenic
1019594086 7:1850422-1850444 CAGAAGCTGCTGCTTTACACTGG + Intronic
1019777849 7:2923124-2923146 CACCAGCTGCTGCTGGTGAGGGG - Exonic
1021234425 7:18124748-18124770 CCCCAGCTGCTGTTACTGACAGG + Intronic
1022500911 7:30881968-30881990 CCCCACCTGCTGCTGCTCGCAGG - Intronic
1024606747 7:51028161-51028183 CAGAAGCTCCTGTTTCTCACTGG - Exonic
1025912961 7:65842105-65842127 CACCAGCTCCTGCCTCACAATGG + Intergenic
1025992442 7:66506082-66506104 AAGCTGCTGCTGCTCCTCACGGG - Intergenic
1026792083 7:73340669-73340691 CACCAGGTGCTGCTCTTCAGGGG - Exonic
1027428860 7:78089251-78089273 CTCCTGCTGATGCTTCTCATTGG + Intronic
1027460677 7:78449189-78449211 CAACAGCTGCTGGTGCTCAGGGG - Intronic
1028231325 7:88309686-88309708 CCCCAGCTTCTGCTTCTAAATGG - Intergenic
1029460028 7:100689111-100689133 CACCTCCTGCTCCTTTTCACTGG - Exonic
1029557217 7:101278804-101278826 CATCAGCTGATGATTCCCACTGG + Intergenic
1030029286 7:105354053-105354075 CAACAGCTGCTGCATCTGCCTGG + Intronic
1030075458 7:105732873-105732895 CACCTGCTGTTTCTTCTGACTGG + Intronic
1033314126 7:140283660-140283682 CACATGGTGCTGCTCCTCACTGG + Intergenic
1036377291 8:8211496-8211518 CAAGAGCTGGTGCTTCTTACAGG - Intergenic
1036500989 8:9313758-9313780 CACCTGCTCCTGCCTCTTACAGG + Intergenic
1036618170 8:10404565-10404587 CGTCAGCAGCTGCTTCTGACAGG + Intronic
1036852257 8:12211655-12211677 CAAGAGCTGGTGCTTCTTACAGG + Intergenic
1036873625 8:12454176-12454198 CAAGAGCTGGTGCTTCTTACAGG + Intergenic
1037943860 8:22974315-22974337 CAACTGCAGCTGCTTCTCAGAGG + Intronic
1039411732 8:37360458-37360480 CTCCTGCTGCTGCCTCTCAGTGG - Intergenic
1039612493 8:38930805-38930827 CACCAGCTGCTGTGTCTCTAGGG + Intronic
1039956213 8:42208930-42208952 CCACAGCTGCTGCTGCTCATGGG - Intergenic
1040474496 8:47764478-47764500 CAGAAGCTGCTGCGTCTCCCGGG - Intergenic
1040880015 8:52194254-52194276 CCCCAGCTGCCACTTCACACTGG + Intronic
1041303144 8:56434109-56434131 CAGCAGCATCTGATTCTCACAGG - Intergenic
1041383261 8:57274353-57274375 CACCATCTGCAGCCTCTCAGAGG + Intergenic
1042379798 8:68100579-68100601 TACCAGCTGTTCCTTCTCCCTGG - Intronic
1042945758 8:74153034-74153056 CACCACCTGGGGCTTCTCCCTGG - Intergenic
1044505715 8:93016764-93016786 CACCTGCTGCTGCCTCTGTCGGG - Intronic
1046482057 8:114835003-114835025 TTCCAGCTGTTGCTTATCACTGG - Intergenic
1048190124 8:132280729-132280751 CACCAGCTGCTCCCTCTGCCTGG - Intronic
1048546981 8:135396447-135396469 CTCCAGCTGTTGCTTCTGCCTGG - Intergenic
1048821732 8:138386430-138386452 CATCAGCTCCTTCTTTTCACTGG - Intronic
1049299793 8:141863439-141863461 GCCCAGCTGCTGCTGCTCTCAGG - Intergenic
1049386187 8:142344259-142344281 CACCAGCTGCTGTTTGGCACGGG - Exonic
1049422757 8:142524232-142524254 CCCCAGCTGCTGGCTCTCCCTGG + Exonic
1049643812 8:143727334-143727356 CAGCAGCTGCACCTTCTCAGTGG + Exonic
1049792857 8:144480171-144480193 CATCAGCTGCTCCTTCTGTCTGG - Intronic
1051044138 9:12853352-12853374 CACCAGCTACTCTTTCCCACAGG - Intergenic
1053181274 9:35972349-35972371 CGGCAGCTGCGGCTTCTCCCGGG + Intergenic
1057530339 9:95839466-95839488 GACCAGCAGCTGCTTCACACAGG - Intergenic
1057713584 9:97469228-97469250 CACCTGCTTTTGCTTCTCATAGG - Intronic
1059550035 9:115219982-115220004 CCATAGCTGCTGCTTTTCACTGG + Intronic
1061173911 9:128980218-128980240 TACCAGCTTCTCCTTCTCCCAGG - Intronic
1061864973 9:133487521-133487543 CACCAGCTACTGCTCCCCTCAGG + Intergenic
1062090939 9:134678553-134678575 CACCACCTGCTGCTCCTCCATGG + Intronic
1062326759 9:136016269-136016291 CACCAGCTCCAGCTTCTCCCCGG + Exonic
1062654353 9:137594837-137594859 CATGTGCTGCTGCTTCTCAGTGG - Intergenic
1185747522 X:2584397-2584419 CCCCAGCTGCTGGCGCTCACCGG + Intergenic
1187108390 X:16269327-16269349 CACCTGCTTCTGATTCCCACTGG - Intergenic
1189572971 X:42319450-42319472 CACCAGTATCTGCTTCTGACGGG + Intergenic
1190797952 X:53761296-53761318 CTCCAGATGGGGCTTCTCACAGG - Intergenic
1190917207 X:54819914-54819936 CTCCAGATGGGGCTTCTCACAGG + Intergenic
1192741069 X:73893076-73893098 CCACAGCTGCTCCTTCCCACAGG - Intergenic
1192884224 X:75320148-75320170 CAACAGCTGCTCCTTCCCTCAGG + Intergenic
1194163581 X:90485915-90485937 CACCAGCTACTGCTTTGCAAAGG - Intergenic
1195653779 X:107314649-107314671 CACCTGCTGCTCCTTCTGCCTGG + Intergenic
1198421267 X:136472565-136472587 CACCAGCTTGTGCTTGTCTCCGG + Intergenic
1199319689 X:146423330-146423352 CACTGGCTGCTGCTTCATACTGG + Intergenic
1200016004 X:153164324-153164346 CACCACCTGAAGCTTCTCCCTGG - Intergenic