ID: 1090800451

View in Genome Browser
Species Human (GRCh38)
Location 11:130168202-130168224
Sequence AAGAGCAAACAGAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 770
Summary {0: 1, 1: 0, 2: 5, 3: 69, 4: 695}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090800451 Original CRISPR AAGAGCAAACAGAATGAGGA AGG Intronic
900377036 1:2359577-2359599 AGGAGCAAAGAGGAAGAGGAAGG + Intronic
900741636 1:4333794-4333816 GAGAATCAACAGAATGAGGAAGG + Intergenic
902468741 1:16633353-16633375 AAGAGAACACAGGATGGGGATGG + Intergenic
904655290 1:32041067-32041089 AAGACCAAACTGAAAGAGGCAGG + Intronic
904807737 1:33143572-33143594 AAGAGGAATGAGAACGAGGATGG - Intergenic
905069914 1:35216579-35216601 AAGAGAAAAGAGAAAGAGGCGGG - Intergenic
905150588 1:35923798-35923820 AAAACAAAACAGAATGAGGTGGG + Exonic
905622456 1:39460362-39460384 TGGAGCACACAGAATGAGAATGG - Intronic
906232250 1:44173753-44173775 AAGAGAAAATAGAGGGAGGAAGG + Intergenic
906884445 1:49629411-49629433 AAGAGCTATCATAGTGAGGAAGG - Intronic
907913297 1:58846101-58846123 CAGAGGAAACAGCATGGGGAAGG - Intergenic
908241816 1:62194868-62194890 AGGAGCGAACAAAGTGAGGATGG - Exonic
908580671 1:65512637-65512659 AAAAACAGACAGGATGAGGAGGG + Intronic
908852042 1:68386489-68386511 TAGAGCAAAGAGCAGGAGGATGG - Intergenic
909081541 1:71118384-71118406 AAGAGAAAAAAGAAAGAGAAGGG + Intergenic
909665141 1:78123664-78123686 ACTGGCAAACAGAATGTGGATGG + Intronic
909972740 1:82009730-82009752 AAGAGAAATAAAAATGAGGATGG - Intergenic
910013372 1:82492445-82492467 AAGAGCTAACAGGAAGGGGAGGG + Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910247782 1:85160658-85160680 AATAGCACAAAGAATGAGGGGGG - Intronic
910434344 1:87190152-87190174 AGCAGCAAACAGACTGCGGAGGG - Intergenic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
911720633 1:101187467-101187489 AAGAGTAAACAAAATGTGGAAGG + Intergenic
912306206 1:108570223-108570245 AGGAGAAAACAGAATGATAAAGG + Intronic
913691177 1:121281339-121281361 AAGAAGAAAGAGAATGAAGAAGG - Intronic
914146365 1:144998633-144998655 AAGAAGAAAGAGAATGAAGAAGG + Intronic
914425152 1:147569184-147569206 AAGAGGGAACAGAATGTGCAAGG + Intronic
914926395 1:151892251-151892273 AGGAGCAAGTAGAAGGAGGAGGG + Intronic
915865669 1:159495348-159495370 GAGAGCAAGCAGAAACAGGATGG - Intergenic
916014230 1:160734348-160734370 CTTGGCAAACAGAATGAGGATGG - Intergenic
916084966 1:161261853-161261875 GAGAGCAAACAGGATAATGAAGG - Intronic
916312307 1:163410721-163410743 GAGAGCAGACTGAATGAGGGAGG - Intergenic
916608271 1:166364125-166364147 GAGGCCAAAAAGAATGAGGAGGG - Intergenic
916952227 1:169792315-169792337 AAGGTCAAATAGAATGAAGATGG + Intronic
917068791 1:171126587-171126609 AAGAGAAAACAGAAACAGGTTGG + Intergenic
917938911 1:179896678-179896700 AATAGCAGGCAGAATGAGGACGG + Intronic
918421024 1:184364291-184364313 AAAAGCTAACACAATGAGGATGG + Intergenic
918460308 1:184769730-184769752 AAGTGGAAAGAGAAAGAGGAAGG + Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919561689 1:199127832-199127854 AAAAGCAAGAAGATTGAGGATGG + Intergenic
920197982 1:204242178-204242200 ATGAGCAAACAGAACCAGGCGGG + Intronic
920350340 1:205333934-205333956 AAGAGAAAAAAGAAAGAAGAGGG - Intergenic
920478501 1:206299815-206299837 AAGAAGAAAGAGAATGAAGAAGG - Intronic
920887064 1:209938809-209938831 AACAGCAAACAGAAGGGGAACGG - Intronic
921759713 1:218899048-218899070 AAGAGCAGGCAGAGAGAGGAAGG - Intergenic
921787220 1:219245074-219245096 AAGAGAAAGAAGAAAGAGGAAGG - Intergenic
922350733 1:224732946-224732968 AAGAAAAAAAAGAATGAGGAGGG + Intronic
922514905 1:226200068-226200090 AAGAGGAAATAAAAAGAGGAAGG - Intergenic
922551690 1:226498769-226498791 AAGAGCAAAGAGAGGCAGGAGGG + Intergenic
922601242 1:226856127-226856149 AAGAGAAAATAGGAGGAGGAAGG - Intergenic
922653820 1:227363705-227363727 AAGTGGAAAAAGAATGAGGCCGG + Intergenic
922663032 1:227446962-227446984 AAGAGCAAACAGAAGGCTGGGGG - Intergenic
922755604 1:228095061-228095083 AAAAACAAACAGAATGAAAAAGG - Intronic
923467965 1:234265888-234265910 AAGAGCAAACACAAAGGGCAGGG - Intronic
924114544 1:240732225-240732247 CAGAGAAAAAAGAATGAGGCAGG - Intergenic
924262183 1:242243353-242243375 AAGAACAAATTAAATGAGGAGGG + Intronic
924549551 1:245062835-245062857 ATGAGCAGACAGATTGAAGAGGG - Intronic
924687328 1:246307741-246307763 AAGAGAAAGCAGCACGAGGAGGG + Intronic
1063245110 10:4209556-4209578 AAGAGAAACCAGAATAAGGGTGG - Intergenic
1063590143 10:7387632-7387654 AAGAGGAAACCAAAGGAGGATGG + Intronic
1063879747 10:10518944-10518966 CAGACCAAAAAGAATCAGGAAGG + Intergenic
1064054033 10:12082330-12082352 GAAAGAAAACAGAATGAGGCGGG - Intronic
1064689964 10:17906388-17906410 AAGAGGAAAGACAAAGAGGAAGG - Intronic
1064839499 10:19574816-19574838 AAGTTCAGAGAGAATGAGGAGGG + Intronic
1065163926 10:22954732-22954754 TAGAGAAAACAAATTGAGGAGGG - Intronic
1065348038 10:24767723-24767745 AAGAGAAAACAAAAGAAGGAAGG - Intergenic
1066379896 10:34892328-34892350 TCGAGGAAACAGAATGAGGAGGG + Intergenic
1066466273 10:35653110-35653132 AAGAGTGACCAGAATGAGGATGG + Intergenic
1066561639 10:36676146-36676168 AAAATCAAAGAGAATAAGGAAGG + Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067512349 10:46906497-46906519 GAGAGCAAAGAGAAAGAGGATGG + Intergenic
1067649894 10:48145325-48145347 GAGAGCAAAGAGAAAGAGGATGG - Intergenic
1068398284 10:56493550-56493572 AAGAGCTAAGAGGATGAGGAGGG - Intergenic
1068418098 10:56752127-56752149 AAGAGCTGAAACAATGAGGATGG - Intergenic
1069145020 10:64880812-64880834 AAGAAAAAGCAGAATGTGGAAGG + Intergenic
1069686819 10:70324049-70324071 GAGAGAGAACAGGATGAGGAGGG + Intronic
1069875311 10:71559439-71559461 AATAGCAAAAAGGAAGAGGAGGG + Intronic
1069950708 10:72016340-72016362 AAGAAGAAAAAGAAAGAGGAAGG + Intergenic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070476810 10:76836841-76836863 GAGGGCAAAGAGGATGAGGAAGG - Intergenic
1070647873 10:78214029-78214051 GAGAGCAAGCAGCATGAGGCTGG - Intergenic
1070715078 10:78714090-78714112 AAGAACAAAAGGAATAAGGAAGG - Intergenic
1071144706 10:82554921-82554943 AACAGCAGACAGCATGAGGACGG - Intronic
1071488665 10:86121083-86121105 AAGAGCAACCACAAGGAGCAAGG + Intronic
1073072250 10:100802119-100802141 AAGACCAAACAGAGCAAGGAAGG - Intronic
1073112602 10:101071578-101071600 AAGAGGACACAGAAGAAGGAAGG - Intergenic
1073274768 10:102300751-102300773 AGAAGCAAACTGAATGACGACGG - Intronic
1074831467 10:117252601-117252623 AAGAAGAAAGAGAATGAGGGAGG + Intronic
1074975517 10:118577978-118578000 GAGAGCTATCAGAATGGGGAAGG + Intergenic
1075909353 10:126110489-126110511 AAGAGCAAAGAGAAAGAGAACGG + Intronic
1076349592 10:129806953-129806975 AAGAGCAACCTGAATGAAGCAGG - Intergenic
1077534685 11:3117972-3117994 AAGAGAAAATAGTAGGAGGAAGG - Intronic
1077826986 11:5821227-5821249 AAGACCAAGCAGATTCAGGAAGG + Exonic
1078927524 11:15887978-15888000 TAGAGCATGCTGAATGAGGAAGG - Intergenic
1078941419 11:16010602-16010624 AAGAGAAAAAAGAAACAGGATGG + Intronic
1078941428 11:16010675-16010697 GAGAGCAGAGAGAAAGAGGAGGG + Intronic
1079231193 11:18650152-18650174 AAAAGCATAAAGAAAGAGGAAGG + Intergenic
1079248361 11:18769766-18769788 TAGAGCAAATAGAAAGAGCAAGG + Intronic
1079260768 11:18878106-18878128 AAGAGAAATCAGATTGTGGATGG + Intergenic
1079300675 11:19276387-19276409 TAGGGCAAACATAATGAGGATGG + Intergenic
1079459198 11:20665263-20665285 AAGTGCAAAGATCATGAGGATGG + Intergenic
1079599621 11:22295145-22295167 AAGCCCAAACAGAGTGAGGTTGG + Intergenic
1079737195 11:24012155-24012177 AGCAGAAGACAGAATGAGGAGGG + Intergenic
1080159778 11:29159912-29159934 AAGAGAAAAGAGGAGGAGGATGG + Intergenic
1080317220 11:30963938-30963960 AACAGCAATGAGAATTAGGAAGG - Intronic
1080515730 11:33017697-33017719 CAGAGCACACAGAAAGAGAATGG - Intronic
1080871282 11:36239384-36239406 AACAGCAAACAGAAAAAGGAGGG - Intergenic
1083402450 11:62433304-62433326 AAGAGGAAAGAGAAAGGGGAGGG + Intergenic
1083487130 11:62990284-62990306 AAGAGGAAAGAGAATGAGAAGGG - Intronic
1084347671 11:68566313-68566335 AGGAGGAAAGAGAAGGAGGAAGG - Intronic
1084653207 11:70500966-70500988 AAGAAACAACAGAATGAGGCAGG - Intronic
1085080738 11:73632113-73632135 AAGAGCAAACAGAAGGTTGGAGG + Intergenic
1085935236 11:81133712-81133734 AAGAGGAAAGAGAATGAGTCTGG + Intergenic
1086047293 11:82547878-82547900 AAGAGAAAAAAGAAAGAGGAGGG + Intergenic
1086651263 11:89294227-89294249 AAAAGAAAACAGAATGAAAAGGG - Intronic
1088181648 11:107120127-107120149 GAGAGGAAACAGATTGAGGAAGG + Intergenic
1088868418 11:113870879-113870901 AAAAGCAAACAAGAGGAGGAAGG + Intronic
1089004176 11:115077187-115077209 AAGAGAATACAGAATGTCGAAGG + Intergenic
1089944443 11:122453746-122453768 AAGAGGAAACATAATGAGGAAGG + Intergenic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090568435 11:128021201-128021223 AAGAAAAAACATAAGGAGGAGGG + Intergenic
1090725606 11:129524189-129524211 GAGAGAAAACAGAATTAGAATGG + Intergenic
1090800451 11:130168202-130168224 AAGAGCAAACAGAATGAGGAAGG + Intronic
1090843334 11:130511783-130511805 AAGAACAAAAAGGCTGAGGAAGG - Intergenic
1091169196 11:133505483-133505505 AAGAGGAAGCAGATTGAGGGAGG - Intronic
1091249622 11:134131894-134131916 AGGAGCAAAAAGAAAAAGGAAGG + Intronic
1091349484 11:134881569-134881591 AAGAGCAAAAAGGCAGAGGAGGG + Intergenic
1091362964 11:134992790-134992812 ATGAGCTAACAGAGAGAGGAAGG - Intergenic
1091607939 12:1972854-1972876 AAGAGAGAAAAGAAAGAGGAAGG + Intronic
1092212090 12:6652926-6652948 AAAGGCAAAAAGAGTGAGGAGGG - Exonic
1092290014 12:7154543-7154565 AAGAGCAAGCCGGATGATGAGGG + Intronic
1092395539 12:8122367-8122389 GAGTGCAAGCAGAGTGAGGAGGG + Intergenic
1092606588 12:10126950-10126972 AAGAAGAAATAGAATGAGGGAGG + Intronic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093314728 12:17634148-17634170 CAGAACAAACAGAATGAAGGGGG - Intergenic
1095514984 12:42995637-42995659 AAGAGCAAAGAGATAGAGTAGGG + Intergenic
1095714987 12:45334401-45334423 AAGAGCCAAAATATTGAGGATGG - Intronic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096231352 12:49898502-49898524 AAAAACAAAAAGAATGAGCAAGG - Intronic
1097285792 12:57876244-57876266 GAGAGCAAAAAGAGTGAGGCAGG + Intergenic
1098957722 12:76704826-76704848 CTGAGCAAACAGAAAGATGAAGG - Intergenic
1099061258 12:77912210-77912232 AAGATCATACAGAATTAGAATGG + Intronic
1099141155 12:78977142-78977164 AAGGGCAAAGAAAGTGAGGAAGG + Intronic
1099319990 12:81134168-81134190 AAGAGCAAAGAATATGAGGTCGG + Intronic
1099830877 12:87840972-87840994 AAGAGAAAACAGAAAAAGCAAGG - Intergenic
1100085372 12:90903999-90904021 AAGAGCTATCATAATGGGGAAGG - Intergenic
1100780690 12:98023032-98023054 AAGAGCAAACAGAAGAGGCAAGG - Intergenic
1100797060 12:98193438-98193460 AAGCCAAAACAGAATTAGGAAGG - Intergenic
1101044931 12:100794993-100795015 AAGAGTCAACAGAAGGAGAAGGG - Exonic
1101145728 12:101838867-101838889 CAGAGCAAACAGAATAAGGGGGG - Intergenic
1101560234 12:105850443-105850465 AACAGCAGGCAGCATGAGGAGGG - Intergenic
1101923599 12:108953042-108953064 AAGAAAGAAAAGAATGAGGAAGG + Intronic
1102454061 12:113060762-113060784 AGGAGAAAACAGAATGGGGCGGG - Intronic
1102906992 12:116684297-116684319 AAGAAAAAAAAGAATGAAGAAGG + Intergenic
1102956243 12:117060938-117060960 ACGAGAAAACAGACTCAGGAAGG - Intronic
1103162840 12:118744492-118744514 GAGAGAAAAGAGAAAGAGGAAGG + Intergenic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103680663 12:122690966-122690988 AATAACAAGCAGAAAGAGGAAGG - Intergenic
1104270547 12:127278935-127278957 AGGAGCAGAGAGAATGAGGTGGG - Intergenic
1105250239 13:18692658-18692680 AAGAGGATAAAGTATGAGGAAGG - Intergenic
1105391103 13:19979035-19979057 AAGTGCTAACAGAAAGAGGGGGG - Intronic
1105579165 13:21677319-21677341 AAGAGCAAAGAAAAGAAGGAAGG - Intronic
1106293454 13:28388015-28388037 AAAAGCAAACAGAATGATTGAGG - Intronic
1106948268 13:34853344-34853366 AAGAGGAAACATTACGAGGAAGG + Intergenic
1107275888 13:38678746-38678768 CAGAGCAAACAAAATTATGAGGG + Intergenic
1107573312 13:41686907-41686929 AAGCCCAAACAGGATGAAGATGG - Intronic
1108148094 13:47500976-47500998 AAGGGCAGACAGAATGAGAAGGG - Intergenic
1109709947 13:66146533-66146555 CAGAGCAAAAAGGAGGAGGACGG + Intergenic
1110006654 13:70280541-70280563 AAAAGCAGACAGAATCAAGAGGG - Intergenic
1110186580 13:72682040-72682062 CACAGCATAAAGAATGAGGAAGG + Intergenic
1110212914 13:72993888-72993910 AATAACAAACAGAATGAGGGAGG + Intronic
1110300005 13:73915153-73915175 AAGAGAAGACAGTGTGAGGATGG - Intronic
1110785834 13:79524587-79524609 CATAGCAAACAGATTCAGGATGG + Intronic
1112011032 13:95294008-95294030 AAGAGCTCACACAATGAGGGAGG + Intronic
1112921525 13:104618655-104618677 AGGAGCAAATACAATGAGGAAGG - Intergenic
1112946817 13:104938417-104938439 AAGAGGAAATAGAATCAGCAAGG - Intergenic
1113164261 13:107420238-107420260 AAGACAAAACAAAAAGAGGAAGG + Intronic
1113186911 13:107698101-107698123 ATCAGTAAAAAGAATGAGGATGG - Intronic
1114188878 14:20425685-20425707 AAGATGAAAGAGAATGAAGATGG + Intergenic
1114525323 14:23364490-23364512 AAGAGAAGACAGAGGGAGGAGGG - Intronic
1114607717 14:24011339-24011361 AAGAGAAATCAGAAAGAGAAAGG - Intergenic
1115692689 14:35861113-35861135 AAGAGAAATAAGAATGAGAATGG + Intronic
1116666682 14:47785330-47785352 CGTAGAAAACAGAATGAGGAGGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116972136 14:51077061-51077083 AACAGGAAATAGAATGAGCATGG - Intronic
1117009448 14:51455581-51455603 AAGATCACACAGACTGATGATGG - Intergenic
1117287918 14:54305558-54305580 ATGATCAAACAGAAGGAAGAAGG + Intergenic
1117575147 14:57090544-57090566 AAAAGAAAACAGAGTGAGAAAGG - Intergenic
1118533909 14:66737229-66737251 AAGGGGAAAAAGAAAGAGGAAGG - Intronic
1118739135 14:68725973-68725995 AAGAGAATACACAATGAAGATGG - Intronic
1119072442 14:71600536-71600558 CAGAGCAAAAAGAATGAAGCTGG - Intronic
1119147200 14:72328129-72328151 TAGAACAAAAAGAAGGAGGAGGG - Intronic
1119243401 14:73081809-73081831 AAGAGCATTCAGAATGATGCGGG - Intronic
1119250606 14:73150326-73150348 AAGAGGAAAAAGAATGGGGGAGG - Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119449433 14:74695881-74695903 TAGAGCAATCAGTATGAGAAGGG + Intronic
1119558302 14:75570025-75570047 AAGAGGGAACAGAATGTGCAAGG - Intergenic
1120314787 14:82877691-82877713 AAGAGCAAACAGAATTTCAATGG - Intergenic
1120664979 14:87295057-87295079 GAGAGCAAACTGATTGAGGAAGG + Intergenic
1121216527 14:92252815-92252837 GAGAGAAAACAGAAGAAGGAGGG + Intergenic
1121706684 14:96001704-96001726 GAGAGCAAAGAGAAGCAGGATGG + Intergenic
1122020860 14:98836814-98836836 AAGAGAGAACGGATTGAGGATGG - Intergenic
1122021484 14:98841470-98841492 AAGAGCAAAAAGAATTGGGAGGG + Intergenic
1122392789 14:101401803-101401825 AAGAGGAAAGAGAAGGAGAAGGG - Intergenic
1202831018 14_GL000009v2_random:30467-30489 AATAGTAAAAAGAATGAGGTAGG + Intergenic
1123628409 15:22243845-22243867 AAGAGCTAACAGACTGGCGATGG + Intergenic
1124101514 15:26698612-26698634 ATGATAAAACAGAATGAAGAGGG + Intronic
1124446805 15:29741892-29741914 AAGACAAAACAGAATCAGCAAGG - Intronic
1124698018 15:31882740-31882762 AAGAGGAAACTGAGTGAGGTTGG + Intergenic
1124826596 15:33102512-33102534 AAAAGAAGAAAGAATGAGGAAGG - Intronic
1125826295 15:42679354-42679376 TGGAGCATACAGAAAGAGGAAGG - Intronic
1126395595 15:48213202-48213224 AAGGGAAAGCAGACTGAGGATGG - Intronic
1126432128 15:48597557-48597579 AAGAGGAAGCAGAAGTAGGAGGG - Intronic
1126445241 15:48735783-48735805 TAAAGCAAACAGAAGGAAGAGGG + Intronic
1126458021 15:48885755-48885777 TAGTGCAAACAGTGTGAGGAAGG + Intronic
1126753265 15:51898880-51898902 AAGTGAAAAAAGAAAGAGGAGGG - Intronic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1126957945 15:53955768-53955790 AAGAGGCATCAGAATGGGGAAGG - Intergenic
1127165083 15:56236466-56236488 AAGACTAAACAGAAAGAGAATGG + Intronic
1127210103 15:56765385-56765407 AAGAACAAACAGGATGTGGGAGG + Intronic
1127232114 15:57008063-57008085 AAGAGGCAAAAGCATGAGGATGG - Intronic
1127441048 15:59008545-59008567 AAGTGCCAAGATAATGAGGAAGG - Intronic
1127713322 15:61623365-61623387 ATGAGCCAAGAGAATGAGGGAGG + Intergenic
1127735459 15:61835034-61835056 AGGAGGAAACAGAATGGGGTAGG + Intergenic
1127808315 15:62541352-62541374 AAGAAATAACAGAATGAGGAAGG - Intronic
1128095837 15:64954743-64954765 AAGAACAAAAAGAAAGAAGAAGG - Intronic
1128376114 15:67077183-67077205 AAGAGCAAAAATACAGAGGAAGG - Intronic
1129013723 15:72446805-72446827 AAGAGCCAACATACTGAGGATGG + Intergenic
1129325464 15:74798202-74798224 AAGAGCATGAAGACTGAGGAGGG - Intronic
1129338110 15:74866158-74866180 AAGTGAAAACAGGCTGAGGAAGG + Intronic
1129801438 15:78418059-78418081 AAGAGCAGGCAGAATGTGTAGGG + Intergenic
1129905248 15:79182627-79182649 AAGAAAAGACAGAAAGAGGAAGG - Intergenic
1130378528 15:83352214-83352236 AACAGCAGAAAGAATGAGGAAGG + Intergenic
1130394378 15:83489397-83489419 AAAAGCAAACTGGATGAGGGTGG - Intronic
1130853821 15:87823283-87823305 AAAAGCAACCAGTTTGAGGACGG + Intergenic
1130867874 15:87947701-87947723 AAGAGAAAACAGGGAGAGGAAGG + Intronic
1131438508 15:92441341-92441363 AGGAGGAAACAGCATGAAGAGGG + Intronic
1131618443 15:94041657-94041679 AAGAGCAGAAATATTGAGGAAGG + Intergenic
1131942302 15:97580690-97580712 AAGACCTAACAGAATCAGCAAGG - Intergenic
1132109229 15:99090097-99090119 AAGAGGAAAGAGAATGCTGAGGG - Intergenic
1132337196 15:101055594-101055616 AGGAGCAGACAGAATAAGGACGG + Intronic
1132873848 16:2127248-2127270 AAGAACAAAAGGAGTGAGGACGG + Intronic
1133900662 16:9971093-9971115 AAGAGCAGACAGTATGAGGTGGG + Intronic
1134095182 16:11414294-11414316 CAGAGAGAACAGAATGTGGAGGG + Intronic
1134287185 16:12872041-12872063 AAGAGGAAGAAGAAGGAGGAGGG - Intergenic
1135381847 16:22002333-22002355 AAGAGAAAACCTAATGAGGTAGG + Intergenic
1135848367 16:25939798-25939820 TAGGGCAGCCAGAATGAGGAAGG + Intronic
1135862276 16:26067530-26067552 AAGAGAAAACAGAATCAGTGAGG - Intronic
1136397532 16:30001329-30001351 AAATGCAAACAGAAGGAGGATGG - Intronic
1136452170 16:30359609-30359631 AAGAGCAAGAACAAGGAGGAGGG + Intronic
1138274987 16:55727905-55727927 AAGACCAAGCAGAGTGAGAAGGG - Intergenic
1138280174 16:55767153-55767175 AAGACCAAGCAGAGTGAGAAGGG - Intergenic
1138288316 16:55826485-55826507 AAGACCAAGCAGAGTGAGAAGGG + Intronic
1139038570 16:62977149-62977171 AAGAAAAAAATGAATGAGGAGGG + Intergenic
1139191880 16:64873671-64873693 TAGAGTCAAGAGAATGAGGATGG + Intergenic
1139221163 16:65183676-65183698 CAGAGAAATCAGAGTGAGGATGG - Intergenic
1139238468 16:65365398-65365420 AAGAGCAAACACACTGAGTATGG + Intergenic
1140114014 16:72026196-72026218 AAGCCCAGAGAGAATGAGGAGGG - Intronic
1140799915 16:78476928-78476950 AAGAGGGAACTGAAGGAGGAAGG - Intronic
1140845215 16:78880613-78880635 AGGAGCAAAGGGAATGAAGATGG - Intronic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1203116477 16_KI270728v1_random:1495942-1495964 AGGAGCAAACAGGATTAGGGGGG + Intergenic
1143745828 17:8993530-8993552 AGGAGCAAACAGAGTCATGATGG - Intergenic
1143980356 17:10863867-10863889 AAGGGGAAAAAGAAAGAGGAAGG - Intergenic
1144694740 17:17295144-17295166 AAGAAAAAAGAGAATGAGGCCGG - Intergenic
1145304691 17:21667036-21667058 AGGAGCAGAAAGAATGAGGGAGG - Intergenic
1146528219 17:33584953-33584975 AGGAGCAGACAGAGAGAGGAGGG + Intronic
1146629956 17:34462734-34462756 AAGAGCAAACAGGATGATGGGGG + Intergenic
1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG + Intronic
1147030614 17:37632057-37632079 ATGAGCAAACACACAGAGGAAGG + Intronic
1147341864 17:39757138-39757160 AAGAGAGAACACAATGATGATGG + Intergenic
1147497669 17:40933235-40933257 AAGAGGAAAAAGAATGAGGCAGG - Intronic
1147948424 17:44093304-44093326 AAGAGCAAAGAGAGTAAGGCAGG - Exonic
1148006770 17:44438569-44438591 AAGACCAAGCAGAAGGATGAAGG + Intronic
1148015968 17:44522947-44522969 AAAAAAAAAGAGAATGAGGATGG - Intergenic
1148144343 17:45353216-45353238 AAGGGGAAACACACTGAGGAGGG - Intergenic
1148488808 17:48009898-48009920 ATGAGCAAAGACTATGAGGATGG - Intergenic
1149664345 17:58355287-58355309 AAGACCAAAAAGAATAAGCAGGG + Intronic
1149940706 17:60862295-60862317 AACAAAAAACAGAATGAGGCTGG + Intronic
1150235957 17:63592902-63592924 AAGAGAAAAGAGAAAAAGGAGGG - Exonic
1151467481 17:74296758-74296780 AAGAGGGAGCAGAATGAGGCTGG - Intronic
1151652103 17:75476398-75476420 AAGAGGAAAGAGAAGGAGGGAGG - Intronic
1152034023 17:77860986-77861008 AAGAGCAAGCAAAGTGGGGATGG + Intergenic
1152036213 17:77874712-77874734 AAGAGGAAACAGGCTCAGGATGG - Intergenic
1152310428 17:79546656-79546678 AAAAAAAAATAGAATGAGGAAGG - Intergenic
1152496976 17:80680094-80680116 AAGAGCCAGCAGGCTGAGGAGGG - Intronic
1203173510 17_GL000205v2_random:174204-174226 AAGAGCACAGAGTATTAGGAAGG + Intergenic
1153159863 18:2192018-2192040 AAGAGCAAACATAGTGATTATGG + Intergenic
1153359879 18:4182231-4182253 AAGAACAAGCAGAAGCAGGAAGG + Intronic
1153978362 18:10288927-10288949 AAGAGCACAGGGAATCAGGATGG - Intergenic
1155554343 18:27001641-27001663 CCCAGCAAACAGAATCAGGAGGG - Intronic
1156929879 18:42628815-42628837 CATAGCAAACAGATTGAAGATGG + Intergenic
1156957130 18:42980685-42980707 AACAGAAAACCCAATGAGGAAGG + Intronic
1157081142 18:44526634-44526656 AAGAGGCAACAGAATGCAGAAGG + Intergenic
1157436232 18:47671802-47671824 GAGGGCACTCAGAATGAGGATGG + Intergenic
1157560316 18:48640811-48640833 AATAACAAACAGGATGAGGCTGG - Intronic
1158488740 18:57891328-57891350 GAGAGCAACCAGAATGGGGTGGG - Intergenic
1158960912 18:62587132-62587154 AAGATCAGAAAGAATGGGGAGGG + Intronic
1159438491 18:68447796-68447818 AAGAGCTATCAGAATCAGGAAGG - Intergenic
1159855027 18:73576244-73576266 CAGAGCAAACAGAACAAGGCTGG - Intergenic
1160443236 18:78908494-78908516 AACAGCAAACAGAAAGAAAAAGG + Intergenic
1161970658 19:7578044-7578066 AAGAGGACACCGAAGGAGGAAGG + Intergenic
1162163243 19:8734616-8734638 AAGAGAAAGCAGATTGATGATGG + Intergenic
1163793951 19:19325125-19325147 AACAGCAGAGAGAATGAGCAAGG - Intronic
1163913455 19:20216960-20216982 AAGAGCAAACAAGATTAGAAAGG - Intergenic
1163926760 19:20353257-20353279 AAGAGCACACAGAGGGGGGAGGG - Intergenic
1163929184 19:20372308-20372330 AAGTACTTACAGAATGAGGAAGG + Intergenic
1166348431 19:42181447-42181469 ATGAACAGGCAGAATGAGGAGGG - Intronic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167308685 19:48723608-48723630 ATGAGGAAACAGAATCAGGTAGG - Intronic
1167565572 19:50254240-50254262 AAAAGAAAACAAAATGAGCAAGG + Intronic
1167696108 19:51016373-51016395 AAGAGAAAAGAAAATGTGGAAGG - Intronic
1167839848 19:52106778-52106800 AAGAGAAAATAGCAGGAGGAAGG - Intergenic
1168181794 19:54666708-54666730 AAGAACACACAGCCTGAGGACGG + Exonic
1168433809 19:56302326-56302348 AAGAGGAAAGGGAAGGAGGAAGG - Intronic
1202641677 1_KI270706v1_random:97306-97328 AATAGTAAAAAGAATGAGGTAGG - Intergenic
925554672 2:5116923-5116945 AAAAAAAAAAAGAATGAGGAAGG + Intergenic
926033387 2:9613030-9613052 TAGAGCCAACAGGATGAGGGAGG + Intronic
927248351 2:20976363-20976385 AAGATCAAATAGAAAGATGAAGG - Intergenic
927250262 2:20990184-20990206 AAGAGGAAAGGGAAAGAGGATGG - Intergenic
927493766 2:23538397-23538419 AAGATAAAACAGAATAAGAATGG - Intronic
928092663 2:28385117-28385139 CAGGGCAGACAGCATGAGGAAGG - Intergenic
928320688 2:30280833-30280855 AAGAGAAAACAGCACGTGGATGG - Intronic
929178348 2:39004647-39004669 AATAGAAACCAGAATGAGAAAGG + Intronic
929479630 2:42292431-42292453 TAGAGCAAATAGAATGAACAAGG + Intronic
929604070 2:43224120-43224142 AAGAGGAAACCGAAAAAGGAGGG + Exonic
929809671 2:45178998-45179020 AACAGCAAACAGCACAAGGATGG + Intergenic
930042304 2:47135942-47135964 AATAGCCAACACAATGATGAAGG - Intronic
930084071 2:47480240-47480262 AAGAGGAAAGGGAAGGAGGAAGG - Intronic
930198453 2:48530651-48530673 AACAGCAGTCAGAAGGAGGAGGG - Intronic
930403364 2:50921176-50921198 AACATTAAACACAATGAGGATGG + Intronic
930443966 2:51446895-51446917 AAGAGTAGAAAGAATGAGAAAGG - Intergenic
930894370 2:56428166-56428188 AAGAGCAGACATCAAGAGGATGG - Intergenic
930996561 2:57726490-57726512 AAGAGCAAACACAATGTTGAAGG - Intergenic
931153092 2:59597064-59597086 ATGAGCAAAATGAATGAAGAAGG - Intergenic
931473007 2:62558274-62558296 AAAAGCAAAGAGAATCACGAGGG - Intergenic
931786332 2:65622425-65622447 AGGGGAAAAGAGAATGAGGAGGG + Intergenic
932123345 2:69121123-69121145 ATGAGCACACAAAAGGAGGAGGG - Intronic
932783966 2:74583347-74583369 AACAGCAAAAAGGATGGGGAGGG + Intronic
932881118 2:75503108-75503130 AAGAGCAACCAGACTGGGTAAGG + Intronic
933012767 2:77088726-77088748 AGGAGCAAAGAGCAGGAGGACGG - Intronic
933628645 2:84631729-84631751 AAGAGCCTTCAGAATGAGCATGG + Intronic
934059721 2:88282998-88283020 CAGAGCACACAGAATGAGGTGGG - Intergenic
934524435 2:95042899-95042921 GAGAGCAAACAGAGTAAGAAGGG - Intronic
934625627 2:95848142-95848164 AAGGAAAAACAGAATGAGAAGGG + Intronic
934807944 2:97253174-97253196 AAGGAAAAACAGAATGAGAAGGG - Intronic
934829566 2:97504013-97504035 AAGGAAAAACAGAATGAGAAGGG + Intronic
935449526 2:103192635-103192657 AATATAAAACAGAATGAAGAAGG + Intergenic
935957532 2:108392513-108392535 AAGAGACAACAGAAAGAGAAAGG + Intergenic
936535935 2:113311280-113311302 CAGAGCAAACACAGTTAGGAAGG - Intergenic
936683279 2:114799334-114799356 AAGAGAAAACAGAATTAGTAGGG + Intronic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
938194073 2:129310594-129310616 AAGAGCAAACAGATTCAGAGTGG + Intergenic
938303918 2:130237082-130237104 AAGAGCAAACACACTGGTGAGGG + Intergenic
938452763 2:131437203-131437225 AAGAGCAAACACACTGGTGAGGG - Intergenic
938842792 2:135179259-135179281 AAGAAAGAACAGAATGAGGCTGG + Intronic
939073783 2:137575818-137575840 AAGAGTAAACACTATTAGGAAGG - Intronic
939163664 2:138617354-138617376 AAGACCAGACAGAATGTGGCAGG - Intergenic
939335407 2:140820889-140820911 AAGAAGCAACAGAAAGAGGAGGG - Intronic
939761729 2:146190890-146190912 AAAAGCAAAAACAAAGAGGAGGG + Intergenic
940276892 2:151948996-151949018 GAGAGCAAGCAGAAAGAGGTAGG - Intronic
940689212 2:156894203-156894225 AAGAGCACACAGAATGTTGATGG + Intergenic
941404026 2:165066689-165066711 TAGAGAAAACAGAAAAAGGAAGG + Intergenic
941405769 2:165085385-165085407 AAGAGTAAACAATAGGAGGAAGG - Intergenic
941628384 2:167856261-167856283 AAGAGCAAAAAGCAGAAGGAAGG + Intergenic
941691801 2:168507843-168507865 GAGAAGAAAGAGAATGAGGAAGG - Intronic
941726350 2:168864852-168864874 ACGAGAAAAAAGAAGGAGGATGG + Exonic
942395961 2:175549901-175549923 AAAAGTAAACAGGAAGAGGAAGG - Intergenic
943173526 2:184435570-184435592 AAGAGTAAAGAGAATGTGGAAGG + Intergenic
943426884 2:187749144-187749166 AAGGGCAAGCAGAATGGTGAGGG + Intergenic
943548879 2:189313827-189313849 AAGATCAAACAAGATGAAGAAGG + Intergenic
945782660 2:214195699-214195721 AGTAGAAAACAGAATCAGGAGGG + Intronic
946463663 2:219892192-219892214 AAGAGGAAGGAAAATGAGGAGGG + Intergenic
946826187 2:223680618-223680640 AAGAGAAAATAGACTGAGCATGG + Intergenic
947099779 2:226607453-226607475 AAGGGCAAACATAAAAAGGACGG + Intergenic
947300457 2:228683281-228683303 AACAGCAAACAACATGAGGGTGG + Intergenic
947311659 2:228809614-228809636 AAGAGCAAGCAGAAACAGGGTGG - Intergenic
947447762 2:230177647-230177669 AAGTGCATTCGGAATGAGGATGG - Exonic
947450315 2:230202451-230202473 AAAAGTACAGAGAATGAGGATGG - Intronic
947459640 2:230292657-230292679 AAGTGTATACAGACTGAGGATGG + Exonic
947469943 2:230392098-230392120 AAGTGTATACAGACTGAGGATGG + Exonic
947952006 2:234156235-234156257 AAGAAGAAAAAGAAAGAGGAGGG - Intergenic
1168862206 20:1053687-1053709 AGGAGGAAACAGGCTGAGGAGGG - Intergenic
1168981171 20:2005052-2005074 AAGAGCAAACACCCTGAGGTGGG - Intergenic
1169175404 20:3507622-3507644 AACACCAAACAGGATGAGGAAGG + Intronic
1169512973 20:6284856-6284878 AAAGTCAAACAGAGTGAGGAAGG + Intergenic
1169799669 20:9502164-9502186 AAGAACAAAAAAAATGAGGGCGG - Intergenic
1170323787 20:15133232-15133254 AGGAGAAAACAGTATGAGAAAGG + Intronic
1170356318 20:15495939-15495961 AAGAGGAAAGAGCATGAGCAAGG + Intronic
1170412953 20:16110050-16110072 AAGAGAAAACACACTGAGGTGGG + Intergenic
1170808431 20:19654454-19654476 CAGAGCATACAGAGTGAGAAGGG - Intronic
1172038498 20:32027295-32027317 AAGGGCATACAGTATGAGGAAGG - Intronic
1172361626 20:34316628-34316650 AGGAGCAGAGAGAAGGAGGAGGG + Intergenic
1173069535 20:39749182-39749204 AAGAGAAAATAGAAAGATGAAGG - Intergenic
1173206255 20:40996513-40996535 AAAAGAAAAAAGAAAGAGGAGGG + Intergenic
1174327303 20:49789634-49789656 AAGAGGAACCATATTGAGGATGG - Intergenic
1174373364 20:50109355-50109377 AAGAGAAAAGAGAATGTGGTGGG + Intronic
1174430671 20:50466273-50466295 AAAACCAAACAGGATAAGGAGGG - Intergenic
1175171378 20:57083884-57083906 CAGAGCAGCCAGAGTGAGGATGG - Intergenic
1175303921 20:57963035-57963057 AGGACCAAACAGAATGATTACGG - Intergenic
1175516961 20:59576203-59576225 AGGAGCAAACAGGATGAAGTAGG + Intergenic
1176416348 21:6477373-6477395 AAAAGCAAACAGGCTGGGGATGG + Intergenic
1176610206 21:8875306-8875328 AATAGTAAAAAGAATGAGGTAGG + Intergenic
1176656007 21:9589473-9589495 AGGAGCAGAAAGAATGAGGGGGG - Intergenic
1176670351 21:9728371-9728393 AAGAGCAAAGAGAGGGAAGAGGG + Intergenic
1177303063 21:19275348-19275370 AAGAGCATAAAGAAAGAAGAAGG + Intergenic
1177984164 21:27952525-27952547 AACAGCAATCAGAACAAGGAGGG - Intergenic
1178457266 21:32766954-32766976 AAGAGATAAAAGAATCAGGAAGG - Intronic
1178705375 21:34868534-34868556 CAGAGAAAGCAGAGTGAGGAAGG - Intronic
1179005210 21:37507829-37507851 AGGAGCAACTAGCATGAGGATGG - Intronic
1179564766 21:42240321-42240343 AAGAGCAAACAGGAGGAGCCAGG - Intronic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1179691848 21:43085708-43085730 AAAAGCAAACAGGCTGGGGATGG + Intergenic
1180690093 22:17706736-17706758 AAATGAAAAGAGAATGAGGAGGG - Intronic
1182188245 22:28430517-28430539 GAGTGCAAACAAAATGAGAATGG + Intronic
1182565800 22:31198145-31198167 TAAAGCAAACAGAATGGTGATGG - Intronic
1182769615 22:32785027-32785049 AAGAGGGAAGAGAATTAGGAAGG - Intronic
1182851626 22:33479383-33479405 ATGAACAAACAGAAGGAAGAGGG + Intronic
1184041068 22:41944141-41944163 TAGAGTAAACAAAAAGAGGACGG + Intronic
1184932881 22:47694084-47694106 AAGGGCAAACAGAATTATCATGG + Intergenic
949146187 3:702299-702321 CAGTGCAAACAGCATGTGGAAGG - Intergenic
949386508 3:3508428-3508450 AAAAATATACAGAATGAGGAAGG + Intergenic
949453922 3:4218043-4218065 GAGAGAAACAAGAATGAGGAGGG + Intronic
949665736 3:6337489-6337511 AAGATAAAAAAGAAGGAGGAGGG + Intergenic
949725766 3:7042488-7042510 ACAAGCAAACAGAATGAGTGAGG - Intronic
949934093 3:9103040-9103062 ATAAGCAAACACAATTAGGAAGG - Intronic
949994560 3:9606272-9606294 AAGAATAAAAAGAATGAGGGAGG - Intergenic
950056814 3:10031697-10031719 AAGGGTAGACAGAATGGGGAAGG - Intronic
950403878 3:12792452-12792474 AAAAGAAAAAAGAATGAGGGTGG - Intergenic
951227872 3:20142237-20142259 AGGAGAAAAAAGAATGGGGAGGG - Intronic
951431946 3:22618394-22618416 AAGAGGAAAGAGAAGAAGGAAGG + Intergenic
952567577 3:34677942-34677964 AATGGCAAACAGAATGAGGCTGG - Intergenic
952574285 3:34755919-34755941 AAGGGCAAAAAGAACCAGGAAGG - Intergenic
952637104 3:35545702-35545724 AAAGGCAAACAGACTGAAGATGG + Intergenic
952846271 3:37690420-37690442 AAAACAAAACAGAATGAGGTGGG - Intronic
952985870 3:38782458-38782480 AAGAACAAAGAGAAAGAGAATGG - Intronic
953115218 3:39986259-39986281 AAGTGTAACCAGAATGAGGCTGG - Intronic
953145539 3:40271164-40271186 GAGACCAAGCAGAAAGAGGAAGG + Intergenic
953321779 3:41979050-41979072 AAAAGAAAACAGAATGTGGCTGG - Intergenic
953576958 3:44120624-44120646 GAGAGCAAACAGAATGGGCAAGG + Intergenic
954064158 3:48092574-48092596 CAGAGGAAACAATATGAGGAGGG - Intergenic
954365194 3:50142077-50142099 AAAAGAAAAAAGAAAGAGGAAGG - Intergenic
954599288 3:51855293-51855315 AAGAACTTACAGAATCAGGAAGG + Intergenic
955141850 3:56277526-56277548 AAGAACCTAAAGAATGAGGAGGG - Intronic
955307473 3:57848655-57848677 AAGAGGAAAAAGAAGAAGGAAGG - Intronic
955311168 3:57888091-57888113 ATAAGAAAACAGAAAGAGGAAGG + Intronic
956540446 3:70332405-70332427 ACTTGCAACCAGAATGAGGATGG - Intergenic
956983411 3:74667741-74667763 AAGAGCACACTGAATGAAGGAGG + Intergenic
957167991 3:76699803-76699825 AAGAGGAAACAGGGGGAGGAAGG - Intronic
957386704 3:79505302-79505324 AAGAGGAAGCAGGTTGAGGAAGG + Intronic
957573169 3:81975052-81975074 AAGAGAAAAAAAAATAAGGATGG - Intergenic
957906202 3:86559413-86559435 AAAATCAAATAGAAAGAGGATGG - Intergenic
958136007 3:89492585-89492607 AAGAGCAAAGAAAATTAGTAGGG - Intergenic
958953629 3:100442938-100442960 AAGAGAAAATAGGAGGAGGAAGG + Intronic
959361871 3:105403474-105403496 AAGAGCAAAAACAATCATGACGG + Intronic
959833662 3:110893272-110893294 AAGGACAAAAAGAAGGAGGAAGG - Exonic
959885978 3:111500656-111500678 AAAAGCAAAAAGATTGTGGAGGG + Intronic
959970245 3:112400923-112400945 AAGAGAAAATAGAGGGAGGAAGG + Intergenic
961185915 3:124914981-124915003 AGGAGCAAAAAGAAGGATGAGGG + Intronic
961786609 3:129351102-129351124 CAGAGGAAACAGCATGAGCAAGG - Intergenic
962200023 3:133393270-133393292 AAGAGGAAACAGAATGAGGTTGG - Intronic
962641226 3:137388836-137388858 AAAAGAAGACAGAAAGAGGAAGG - Intergenic
963414320 3:144975189-144975211 AAAAACAAAGAGAATGAGAAGGG - Intergenic
964273364 3:154982646-154982668 AAGAGCTAACAAAATGCGGGTGG - Intergenic
964825731 3:160825910-160825932 AAAAGCAACCAGAATGAGAAGGG - Intronic
964843578 3:161022277-161022299 AACAGCACAGAGAATGGGGAGGG - Intronic
965764526 3:172115937-172115959 AACAGAAATCAGAAGGAGGAGGG - Intronic
966128791 3:176611014-176611036 AAGACCTAACAGAATCAGCAAGG + Intergenic
966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG + Intergenic
966532212 3:180993627-180993649 AAGAGCAAGCAGGAAGTGGAAGG + Intergenic
966999741 3:185322563-185322585 AAGATTATACAGAGTGAGGAAGG - Intronic
967144586 3:186595996-186596018 TAGAGCAAACAGGCTGAGCACGG - Intronic
967205105 3:187112484-187112506 AAGAGAAAAGAGAAAGAGAAAGG - Intergenic
967391607 3:188961708-188961730 AGGAGGAAACAGAACAAGGAAGG - Intronic
967608290 3:191474462-191474484 AAGATCACACAAAATGAGTATGG - Intergenic
967727028 3:192871671-192871693 CAGAGCCAAGAGAATGAAGAGGG + Intronic
1202736888 3_GL000221v1_random:10092-10114 AATAGTAAAAAGAATGAGGTAGG + Intergenic
969582922 4:8076317-8076339 AAAAGCATTCAGAATGCGGAGGG - Intronic
969727780 4:8934091-8934113 AAGAGAAAATAGGAGGAGGAAGG - Intergenic
969918704 4:10515341-10515363 GAGAGAAATCAGGATGAGGATGG - Intronic
970740443 4:19231146-19231168 AAGATCAACAAGACTGAGGAAGG + Intergenic
971068370 4:23061117-23061139 AAGACAAAACAGACTGAGGAAGG - Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971216364 4:24665812-24665834 AAGGGCAGACAGAATGGAGAGGG + Intergenic
972244501 4:37230453-37230475 CAGAGCAAGCTTAATGAGGACGG - Intergenic
972301047 4:37786016-37786038 AAAAGCCAACAGAACAAGGATGG + Intergenic
973064874 4:45776853-45776875 AAGAACAAAAAGAAGGAAGAAGG - Intergenic
973195485 4:47434905-47434927 GAGAGTGAACAGAATGAGGCAGG - Intergenic
973245318 4:48004633-48004655 AAGAGAAAATAGGAGGAGGAAGG + Intronic
973385188 4:49507822-49507844 AATAGTAAAAAGAATGAGGTAGG - Intergenic
973676481 4:53268577-53268599 CAGAGCCTGCAGAATGAGGAGGG + Intronic
973753856 4:54052823-54052845 AAGAGAAAACAGTATGACAAAGG - Intronic
973962783 4:56128547-56128569 AAGTGGAAACACAATTAGGAAGG + Intergenic
974356642 4:60821074-60821096 AAGAGTAATCAGATTGAAGATGG - Intergenic
974499943 4:62686218-62686240 AAGATCAAAAACAATAAGGAAGG + Intergenic
975096209 4:70460400-70460422 AAGAGCAAAAAGAAAGGTGATGG + Intronic
975202471 4:71607759-71607781 AAGCCCAAGCAGCATGAGGAGGG - Intergenic
975875933 4:78837121-78837143 AAGAGCTAAAAGATAGAGGAAGG - Intronic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976103629 4:81593047-81593069 AAGAACAAGCAGAAGGAGCAGGG + Intronic
976278966 4:83307801-83307823 GAGAGAAAAAAGAATGAAGATGG + Intronic
976546615 4:86343101-86343123 AAGAGGGAACAGAATGATCAAGG - Intronic
977004463 4:91547530-91547552 AAAAGTAAACAGAAGGAAGAAGG - Intronic
978247288 4:106589247-106589269 ATGAACAGACAGAAAGAGGATGG - Intergenic
978331545 4:107618571-107618593 AAGAGGAAACAGAAGGTGGTGGG + Intronic
978667470 4:111201888-111201910 CAGAGCAAACAGTATGTGTAAGG - Intergenic
978687862 4:111469535-111469557 AAAAACATACAGAATCAGGAGGG - Intergenic
978915231 4:114117928-114117950 AAGAAAAAACAGAATTAAGATGG - Intergenic
979763867 4:124440873-124440895 ATGAGCAAAAAGAATAAGGCTGG - Intergenic
979887305 4:126045316-126045338 TAGAGCAAAAAGATGGAGGAAGG + Intergenic
980096563 4:128497337-128497359 AACAGCTCACAGAATGAGGAAGG + Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980581769 4:134763471-134763493 AAGAGCAAAAAGTGGGAGGAAGG - Intergenic
981084649 4:140670632-140670654 AAGATCAAACAAAATGGGCAAGG + Intronic
981717009 4:147761688-147761710 AACAGCAAACAGAATGAATTGGG + Intronic
981898072 4:149828263-149828285 AAGAGTAAACAGAAGGCAGATGG - Intergenic
982081839 4:151797874-151797896 AATAGCAAACAGCACTAGGAGGG + Intergenic
982302863 4:153898041-153898063 AAGAGAGAACAGAGGGAGGAGGG - Intergenic
982930959 4:161407371-161407393 GAGAGAAAACTGAATGAGGATGG + Intronic
983033831 4:162837450-162837472 AAGAGCAAACAGGTTAAGCAGGG + Intergenic
983966450 4:173818817-173818839 CAGAACAAAAAGACTGAGGAAGG + Intergenic
983967503 4:173830935-173830957 AAGACAGAACAGAATAAGGAAGG + Intergenic
984290653 4:177789719-177789741 AATAGGAAACAGCATGTGGATGG + Intronic
984715651 4:182922350-182922372 AGGAGCAAACAAAATAAGGGAGG + Intergenic
984765352 4:183396582-183396604 AAGTGGAAACAGAAACAGGAAGG - Intergenic
984777002 4:183490572-183490594 ACCATCAATCAGAATGAGGAAGG - Intergenic
985196846 4:187440007-187440029 AAGAGCAAAGAAAATGGGCATGG + Intergenic
985404426 4:189623163-189623185 AAGAGCAAAGAGAGGGAAGAGGG - Intergenic
1202769050 4_GL000008v2_random:183180-183202 AATAGTAAAAAGAATGAGGTAGG - Intergenic
986118309 5:4803041-4803063 AAGAGAGAAAAGAAAGAGGAAGG + Intergenic
986157445 5:5190812-5190834 AAGAGCCAACTGGGTGAGGAGGG - Intronic
986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG + Intronic
987380656 5:17282896-17282918 TAGAGGAAAGAGAATAAGGAAGG - Intergenic
987651288 5:20743604-20743626 AACAGCACAAAGAATGTGGATGG + Intergenic
987731626 5:21780959-21780981 GAAAACAAAGAGAATGAGGATGG + Intronic
987781363 5:22440591-22440613 TAGAGCAACCAGAACAAGGATGG - Intronic
988093531 5:26571506-26571528 AAGAACAAACTAAATTAGGATGG + Intergenic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
988263085 5:28914499-28914521 AAGAGCAGACACAATGGAGAAGG - Intergenic
988276655 5:29089664-29089686 AAGAGGAAGTAGAAAGAGGAGGG - Intergenic
988474517 5:31572084-31572106 ATGAGCAAACAGGAAGAAGAGGG + Intergenic
988729330 5:33954732-33954754 AAGGGCAAAGGGAATGAGAATGG + Intronic
988731574 5:33977762-33977784 CAGAGCACAGAGAATGTGGAAGG + Intronic
988744273 5:34117839-34117861 AACAGCACAAAGAATGGGGATGG - Intronic
989142325 5:38213879-38213901 TAGAGAAAAGAGAATGAGGAGGG + Intergenic
989169761 5:38462460-38462482 AACAGCAAAGAGAAAGAGCAGGG - Intronic
989202971 5:38784057-38784079 AAGAGAAAACAATTTGAGGAAGG + Intergenic
989408269 5:41086725-41086747 AAGAGAAACCAGAAGGAGGCTGG - Intergenic
989437306 5:41429733-41429755 AAGAGAAAAAGGAATGACGAAGG + Intronic
989783115 5:45293934-45293956 AAGAGGATAACGAATGAGGAAGG + Intronic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
992097393 5:73375665-73375687 AAGAACAAGCAGGAAGAGGAAGG + Intergenic
992292939 5:75298992-75299014 AAGAGAAAATAGGGTGAGGAAGG - Intergenic
992409847 5:76494519-76494541 AAGAGGCAACAGAATGCTGAGGG - Intronic
992549470 5:77847195-77847217 GGGAGAAAAGAGAATGAGGATGG - Intronic
993415731 5:87627766-87627788 AAAATGAAACAGAATGAGGAGGG + Intergenic
993909944 5:93669122-93669144 AAGAACAACTAGAATTAGGAAGG - Intronic
994342064 5:98642006-98642028 AAGAGCAGATAGAATTAGCATGG + Intergenic
995466434 5:112453784-112453806 AAGAGCAGGTAGAATGAAGAAGG + Intergenic
995964079 5:117882961-117882983 AAGACCAAACAGAAGGATCATGG - Intergenic
997630690 5:135366595-135366617 AAGAGCAAGTAGGATGGGGAGGG + Intronic
997953720 5:138262244-138262266 AAGAGAAAACTGAAAGAGGAAGG + Intronic
998155404 5:139783923-139783945 AAGAGCTAGCAGAAGGAGAAAGG - Intergenic
998614828 5:143728397-143728419 AAGGGCCAACAGAAAGAGAAAGG - Intergenic
998770773 5:145542287-145542309 AATAGCAAATAGAAAGAGAAGGG + Intronic
998965710 5:147538468-147538490 CAGAGAAAACAGAATGAACATGG - Intergenic
999128043 5:149261112-149261134 AAGAGCCAACATGCTGAGGATGG - Intergenic
999389103 5:151177312-151177334 AGGAGCATAGAGAATGGGGATGG + Intergenic
999477342 5:151912664-151912686 CAGAGCCAATAGAAGGAGGATGG + Intronic
999505207 5:152187492-152187514 AAAAGCCAACAGACTGAGGATGG - Intergenic
1000012555 5:157246162-157246184 AAAAACAAACAAAATGATGAAGG - Intronic
1000286784 5:159833709-159833731 AAGAGCAAAGGCACTGAGGAAGG + Intergenic
1000406238 5:160891366-160891388 AAGGTCAGAGAGAATGAGGAAGG - Intergenic
1000507177 5:162135785-162135807 AAGAGGAAGCAGGGTGAGGAAGG + Intronic
1000610358 5:163366970-163366992 AAGAGCATCTAGAAAGAGGAAGG - Intergenic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1001399872 5:171440099-171440121 AAGAGGAAACAGGATCAGAAAGG - Intronic
1001699688 5:173697837-173697859 AAATGAAAACTGAATGAGGAAGG - Intergenic
1002038868 5:176495910-176495932 AAGAGAAAAAAAAATGATGATGG + Intronic
1002154121 5:177262191-177262213 AAAATCAAACAAAATGAGGCAGG - Intronic
1002629235 5:180558603-180558625 AAAAGCAAACACAAGAAGGAAGG - Intronic
1003335493 6:5168032-5168054 AACATCAAAAAGAATAAGGATGG + Intronic
1003358694 6:5402103-5402125 AAAAACAACCAGAAGGAGGATGG - Intronic
1003714318 6:8629597-8629619 AAGAGCTAAGAGAATGATGATGG + Intergenic
1003756576 6:9127838-9127860 CAGAGCAAAGAGGATGAGAAAGG - Intergenic
1003841033 6:10119412-10119434 AAAAGCAAACAAAATGAGATGGG + Intronic
1003858218 6:10297158-10297180 ATGAGATGACAGAATGAGGAGGG - Intergenic
1004090051 6:12491910-12491932 AATAGCAAACATAATTAGGGAGG + Intergenic
1004991022 6:21138898-21138920 AAGGGCACACAGAAGGAGAAAGG - Intronic
1005283901 6:24303529-24303551 AAGCGCAAGAAGAATGAGCAGGG - Intronic
1007054855 6:38872624-38872646 AGGCGCAAACAGAATGCGGAAGG + Exonic
1007961748 6:45966644-45966666 AAAAGGAAACAAAAAGAGGAGGG - Intronic
1007982804 6:46176333-46176355 AAGTGAAAACAGAAAAAGGAAGG + Intergenic
1009374699 6:62953004-62953026 GAGACCAAACAGAATGGAGAAGG - Intergenic
1009708915 6:67292376-67292398 AAGTGCAAACACAATGAAGATGG + Intergenic
1009950252 6:70387147-70387169 AAGAGCAAAAAGAAGCAGGGAGG - Intergenic
1010535610 6:77025778-77025800 AAGAGCAAATAGATAGAGGCAGG - Intergenic
1010954724 6:82076988-82077010 AATAGCAAGCAAAATGAAGAAGG - Intergenic
1012627963 6:101427306-101427328 CAGAGCAATGAGAATGGGGATGG - Intronic
1012993859 6:105953483-105953505 AAGAGGAACCAAAATGAAGATGG - Intergenic
1013057951 6:106603462-106603484 AAGAACATGCAGTATGAGGATGG - Intronic
1013334518 6:109141780-109141802 AAGAGCAAACACAGTAAGGCTGG - Intronic
1013764508 6:113558974-113558996 ATGAGCAGACAGAATAAAGATGG - Intergenic
1013836298 6:114340594-114340616 ATGACCAAACAGAGAGAGGAAGG + Intronic
1014199213 6:118590139-118590161 AACAGGAAACAGAGTGAGGGGGG - Intronic
1014629898 6:123775348-123775370 TAGAGCAGAGTGAATGAGGAGGG - Intergenic
1014645547 6:123968236-123968258 GAGAGCAAAGAGAAAGAGGTGGG + Intronic
1015619986 6:135121248-135121270 AAAAGGAAACAGACAGAGGAAGG + Intergenic
1016479526 6:144467226-144467248 ATGAGCAGACAGGAGGAGGAGGG - Intronic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1017200469 6:151748416-151748438 AAGAGTAAAAAGAATGAGGCAGG - Intronic
1017262288 6:152401529-152401551 ATGGGCAAATAGAAAGAGGAAGG + Intronic
1017562736 6:155647656-155647678 AACATTAAACAGAATGAGAAAGG + Intergenic
1017650683 6:156578721-156578743 AAGAGCAAACACAATGGGAGGGG + Intergenic
1017702103 6:157084401-157084423 AAGGGCAAACTGTATGGGGATGG + Intronic
1017844643 6:158246089-158246111 AAGACCATATAGAATGGGGACGG + Intronic
1017996243 6:159534036-159534058 CTCAGCAAACAGAGTGAGGATGG + Intergenic
1018191525 6:161313553-161313575 AAGTGCTTACAGAATCAGGAAGG - Intergenic
1019399736 7:845659-845681 AAAAACAAACAAAATGTGGAGGG - Intronic
1020119759 7:5496395-5496417 AAGAGGAAGAAGAATGTGGAAGG - Intronic
1020451595 7:8325964-8325986 AAGAGCAAAGGCCATGAGGAAGG - Intergenic
1021395012 7:20136743-20136765 AAGTTCATACAGAAGGAGGAGGG + Exonic
1021638036 7:22710622-22710644 AAGGGAAAACAGAATGAAAAGGG + Intergenic
1021867476 7:24972341-24972363 AAGAGAAAAGAGAATGTGGCTGG - Intronic
1023080963 7:36525929-36525951 AAAAGCACAAAGAAAGAGGAGGG + Intronic
1023155074 7:37242071-37242093 GAGAGGAAAAAGAATGGGGAAGG - Intronic
1023226949 7:37979982-37980004 AAGAGCAAACACACTGTTGAGGG - Intronic
1023300431 7:38764643-38764665 GAGATTAAACAGAATGAGGAGGG + Intronic
1023768139 7:43531055-43531077 TAGAGCATACAGAATGAGGAAGG - Intronic
1024382568 7:48715246-48715268 GAGAGTAAAGAGAATGGGGAAGG - Intergenic
1024663603 7:51522798-51522820 CAGAGAAAACAAAAAGAGGATGG - Intergenic
1024955093 7:54910281-54910303 AAGAGTAAACACATTGAGGAAGG + Intergenic
1024997676 7:55285950-55285972 TAAAGGAAACAGAATGAGGCAGG + Intergenic
1025207036 7:56999923-56999945 ACCAGCAAACAGAAGGAGGGGGG - Intergenic
1025244143 7:57303523-57303545 AAAACCAAACAGGATAAGGAGGG + Intergenic
1025282694 7:57639651-57639673 AGGAGCAGAAAGAATGAGGGGGG - Intergenic
1025302023 7:57825766-57825788 AGGAGCAGAAAGAATGAGGGGGG + Intergenic
1025664903 7:63576979-63577001 ACCAGCAAACAGAAGGAGGGGGG + Intergenic
1025871554 7:65439118-65439140 AAGAGGGAACAGTATGAAGAGGG - Intergenic
1026158951 7:67852217-67852239 AAGAGAAAGGAGAAAGAGGAGGG + Intergenic
1026404820 7:70054335-70054357 AAAAGCAAAGAGAAAAAGGAAGG - Intronic
1026474908 7:70726900-70726922 GAGAGGAAAGAGAATGAGGAAGG - Intronic
1026579144 7:71599487-71599509 AAGAGGACACAGAATGATGCGGG - Intronic
1027671564 7:81105719-81105741 AAGAGGAAACATTATGAGTAAGG + Intergenic
1028057238 7:86261453-86261475 AACAGCAAACAGAAATAGCAGGG - Intergenic
1028248258 7:88508995-88509017 AAGGCCAAGCAGGATGAGGAAGG - Intergenic
1028651345 7:93153344-93153366 AAGAGCTTACAGAATGATAATGG + Intergenic
1029629212 7:101739916-101739938 CTGTGCAAACAGACTGAGGAAGG - Intergenic
1030324191 7:108202795-108202817 AAGAACTAAGAGAATGAGAATGG - Intronic
1030644532 7:112045128-112045150 AATAGCCAGTAGAATGAGGAAGG - Intronic
1031028293 7:116705986-116706008 AAGAGCAGTCAGCAAGAGGAAGG - Intronic
1031431918 7:121682324-121682346 CAGTGCAAACTGATTGAGGAAGG + Intergenic
1032210707 7:129911396-129911418 CAGAACAAACAGGATGAGGGAGG + Intronic
1032301337 7:130690099-130690121 AGGAGCAAAGAGCAGGAGGAAGG + Intergenic
1032370951 7:131351282-131351304 AAAAGAAAACAGCAAGAGGATGG - Intronic
1032534554 7:132651498-132651520 AAGAGCAAAAGGCATGAGAAAGG + Intronic
1032577733 7:133073294-133073316 AAGGGCACATAGAATGAGAAGGG - Intronic
1032730612 7:134638511-134638533 AAGTGCAAGTAGAATGAGTAAGG - Intergenic
1032986332 7:137342035-137342057 AAAAGGAAACATAATGAAGATGG + Intronic
1033004596 7:137548004-137548026 AAGAGCAAAGAGAATGAAGAAGG + Intronic
1033385356 7:140869045-140869067 AAAATCAAAAAGAATGAAGAAGG + Intronic
1033449148 7:141447537-141447559 CAGAGCAAGCAGAATGCGGATGG - Intronic
1033669623 7:143478585-143478607 CAGAGCATAAAGAATGAGGAAGG - Exonic
1033757107 7:144404238-144404260 AAAAACAAACAAAATCAGGAAGG - Intronic
1034889501 7:154827613-154827635 AAGCCCAAGCAGAGTGAGGAGGG + Intronic
1036604143 8:10291694-10291716 AAGAGCACACAGAATGATCCAGG - Intronic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036709630 8:11069667-11069689 ATAAGCAAACAGAATAAAGAGGG + Intronic
1036943058 8:13069709-13069731 AGGAACAGAGAGAATGAGGAGGG - Intergenic
1037938334 8:22930071-22930093 AAGAGCAAAGGGAATGTAGAGGG - Intronic
1038503480 8:28064237-28064259 AAGAGGAAACAGAGTGACCAAGG - Intronic
1038829365 8:31040152-31040174 ATGAGCAACCAGAAAGATGAAGG + Intronic
1039256930 8:35729568-35729590 AAGAGAAGACAGAATGTCGAGGG + Intronic
1040040711 8:42914430-42914452 AATAGAAAACAGATTGTGGATGG - Intronic
1040720018 8:50308574-50308596 AAAAGAAAACAGAAGGAAGATGG - Intronic
1041164396 8:55076753-55076775 CACAGCAAACAGATTCAGGATGG + Intergenic
1041360944 8:57053440-57053462 AAGAGAAACCAGAATGAAGAAGG - Intergenic
1042537255 8:69871170-69871192 AAGAGCAAGAAGAAAAAGGAAGG + Intergenic
1042675786 8:71320052-71320074 AAGAACTAGCAGAGTGAGGATGG - Intronic
1042685206 8:71431167-71431189 AAGTGCAAAGAGAAAGAGAAAGG + Intronic
1042767337 8:72338042-72338064 AAGACGTAACAGAATCAGGAAGG - Intergenic
1043407868 8:79957154-79957176 AAGAAAAAACAGAATGTGGCAGG - Intronic
1044175710 8:89119341-89119363 AGGAGGAAACAGAGTGGGGAGGG - Intergenic
1044533356 8:93333004-93333026 AGGAAGAAACAAAATGAGGAAGG + Intergenic
1044624807 8:94226638-94226660 AAAAACAAACAAAGTGAGGAAGG + Intergenic
1044815094 8:96103677-96103699 AAGAGCAAACAGAATGAATGAGG + Intergenic
1045077929 8:98590550-98590572 AGGAGCAAAAAGCAGGAGGACGG + Intronic
1047537016 8:125729256-125729278 AAGACCAAACAGATTGTTGAAGG - Intergenic
1048194533 8:132321506-132321528 GAGAGCAAACAGAAGCAGGAGGG - Intronic
1048305366 8:133280182-133280204 AAGAGAAGACGGGATGAGGAAGG + Intronic
1049298365 8:141855781-141855803 AGGAGCCAACAGCAGGAGGAGGG + Intergenic
1049380724 8:142314474-142314496 AAGAGCAAAAAGGGTGGGGAAGG + Intronic
1049478319 8:142807118-142807140 GAGGGCAGACAGGATGAGGAGGG - Intergenic
1050460427 9:5872971-5872993 AAAAGCAAAGAGAAAAAGGATGG + Intergenic
1050574970 9:6985332-6985354 AAGAGCAAAGGCAATGAGGCTGG - Intronic
1050784249 9:9379494-9379516 AATGGCAAACAGAATGTTGAAGG - Intronic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052037701 9:23701634-23701656 AAGAGGGAACAGAAGGAGAAGGG + Intronic
1052519908 9:29533433-29533455 AATATCAAAAAGAATGAAGAAGG + Intergenic
1052605955 9:30701002-30701024 AATATCAAACAGTATGGGGAAGG - Intergenic
1052721824 9:32180854-32180876 AATAGTACACAGAATGAGGCTGG + Intergenic
1053146212 9:35713844-35713866 AAGAGAAAAAAGAAAAAGGAAGG + Intronic
1053278556 9:36801476-36801498 AAGAGCAAAGAGAAGATGGAAGG + Intergenic
1054360655 9:64112465-64112487 AATAGTAAAAAGAATGAGGTAGG + Intergenic
1055367195 9:75557145-75557167 AAGAAGATAAAGAATGAGGAAGG + Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056509670 9:87291510-87291532 AAGAGAAAAGAAAGTGAGGATGG + Intergenic
1056947688 9:91013780-91013802 AAGAGCAAACATGCAGAGGAGGG - Intergenic
1056965185 9:91159452-91159474 GAGAGGAAAGAGAAAGAGGAGGG + Intergenic
1058111228 9:101032462-101032484 AGGAGCACACAGAAGAAGGAAGG - Intronic
1058408127 9:104700232-104700254 AAAAGCAGACAGATTCAGGATGG + Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1059028055 9:110658460-110658482 AAGACCTAAGAGAATGAGCAAGG + Intergenic
1060096867 9:120798918-120798940 CAGAGCAAACAGTGTGAGAATGG - Intergenic
1060102465 9:120852490-120852512 AAGAACAAAGAGAATGATAATGG + Intergenic
1060214777 9:121732129-121732151 AAGAGGCAACGGAAAGAGGACGG - Intronic
1062195408 9:135270828-135270850 AAGAGCAAATATAATAAGAAAGG - Intergenic
1062388206 9:136323325-136323347 CAAACCAAACAGGATGAGGAGGG - Intergenic
1062497923 9:136840361-136840383 AAGAGCAAGGACAAGGAGGAGGG + Exonic
1203693930 Un_GL000214v1:76895-76917 AATAGTAAAAAGAATGAGGTAGG - Intergenic
1203705613 Un_KI270742v1:40536-40558 AATAGTAAAAAGAATGAGGTAGG + Intergenic
1203558382 Un_KI270744v1:25275-25297 AATAGTAAAAAGAATGAGGTAGG - Intergenic
1203633724 Un_KI270750v1:92933-92955 AGGAGCAGAAAGAATGAGGGGGG - Intergenic
1203642343 Un_KI270751v1:27168-27190 AATAGTAAAAAGAATGAGGTAGG + Intergenic
1186053695 X:5626847-5626869 AAGAGCAGACAGAGGGAGGAAGG + Intergenic
1186115178 X:6297800-6297822 ATGTGGAAACAGAACGAGGAAGG + Intergenic
1186129020 X:6446349-6446371 AAGAGCAAACAGAAGGGGAAGGG - Intergenic
1187192031 X:17044412-17044434 TATAGCAAACAGAATGGTGATGG + Intronic
1187364457 X:18655114-18655136 AAGAGCTCACACACTGAGGAGGG - Intronic
1188134199 X:26474229-26474251 AAGAGGGACCAGTATGAGGAGGG + Intergenic
1189004637 X:36983022-36983044 AAGAACAAACACACTGAGGCAGG + Intergenic
1189363481 X:40370660-40370682 AGGAGCAACCAGAAGCAGGAAGG + Intergenic
1189933811 X:46043513-46043535 TAGAGCAAAAAGGAAGAGGAAGG + Intergenic
1189961192 X:46326420-46326442 AAGAGAAAACACTAGGAGGATGG - Intergenic
1190172184 X:48120595-48120617 AACAGGAAACAGAGTGAGGGGGG - Intergenic
1190180340 X:48186289-48186311 AACAGGAAACAGAGTGAGGGGGG + Exonic
1190183802 X:48217919-48217941 AACAGGAAACAGAGTGAGGGGGG - Intronic
1190189719 X:48267352-48267374 AACAGGAAACAGAGTGAGGGGGG - Exonic
1190193346 X:48295519-48295541 AACAGGAAACAGAGTGAGGGGGG + Intergenic
1190204644 X:48393251-48393273 AACAGGAAACAGAGTGAGGGGGG - Exonic
1190205892 X:48402152-48402174 AACAGGAAACAGAGTGAGGGGGG + Exonic
1190210479 X:48442884-48442906 AACAGGAAACAGAGTGAGGGGGG - Intergenic
1190658476 X:52633856-52633878 AACAGGAAACAGAGTGAGGGGGG - Intergenic
1191731651 X:64342513-64342535 TAGACCAAAGAGAGTGAGGATGG - Intronic
1191900103 X:66032108-66032130 AAGAGGAAACAGAGTCAGAAAGG - Intronic
1192143953 X:68668206-68668228 AAGAGAAAGAAGAAGGAGGAGGG - Intronic
1192191038 X:68991266-68991288 AAGAACAAAGAGATGGAGGAAGG - Intergenic
1193678613 X:84488053-84488075 AAAAGCAGGCAGATTGAGGATGG - Intronic
1194044843 X:88989787-88989809 AAGAGCAAATAGTGGGAGGAAGG - Intergenic
1194260483 X:91688123-91688145 AAGAGCATACAAAATGATAAAGG + Intergenic
1195435996 X:104843688-104843710 GAGAGCAAGCAGAAGCAGGATGG - Intronic
1196906304 X:120439858-120439880 AAGTGGAAACAGGATCAGGAAGG + Intronic
1197652321 X:129078862-129078884 AAAAGCAAATAGAATTAGAAAGG + Intergenic
1198069585 X:133134846-133134868 AGGAGAAAAGAGAATGGGGAGGG + Intergenic
1198460861 X:136861758-136861780 AAGTAAAAACAAAATGAGGAGGG + Intronic
1198871537 X:141180930-141180952 AAGGGGAAAGAAAATGAGGAAGG - Intergenic
1199321172 X:146440990-146441012 AAGAGAAAACAGGGGGAGGAAGG + Intergenic
1199528036 X:148814042-148814064 AAGAGTAAACAGCATGCTGACGG - Intronic
1199805871 X:151299868-151299890 AAGAGGAAACAGAATGGGCAGGG - Intergenic
1200343944 X:155429363-155429385 ATGAGGAAACAGAATCAGGTGGG - Intergenic
1200494021 Y:3859083-3859105 AAGAGTCAACAGACAGAGGAAGG + Intergenic
1200579171 Y:4927188-4927210 AAGAGCATACATAATGATAAAGG + Intergenic
1201486138 Y:14496469-14496491 AAGAGGAGGCAGGATGAGGAAGG - Intergenic
1202074411 Y:21023966-21023988 AAGTACATACAGAATCAGGAAGG - Intergenic
1202273667 Y:23094715-23094737 AAGAGAAGAGAGAAGGAGGAAGG + Intergenic
1202292360 Y:23325966-23325988 AAGAGAAGAGAGAAGGAGGAAGG - Intergenic
1202426663 Y:24728460-24728482 AAGAGAAGAGAGAAGGAGGAAGG + Intergenic
1202444126 Y:24941626-24941648 AAGAGAAGAGAGAAGGAGGAAGG - Intergenic