ID: 1090801348

View in Genome Browser
Species Human (GRCh38)
Location 11:130174473-130174495
Sequence GGCCCTCTGCTGCTTCTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 425}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090801342_1090801348 0 Left 1090801342 11:130174450-130174472 CCAAATCCAGTGTTGCTCTCCTG 0: 1
1: 0
2: 2
3: 21
4: 231
Right 1090801348 11:130174473-130174495 GGCCCTCTGCTGCTTCTCCTGGG 0: 1
1: 0
2: 3
3: 46
4: 425
1090801341_1090801348 16 Left 1090801341 11:130174434-130174456 CCAAATCTATCTGACTCCAAATC 0: 1
1: 3
2: 26
3: 151
4: 879
Right 1090801348 11:130174473-130174495 GGCCCTCTGCTGCTTCTCCTGGG 0: 1
1: 0
2: 3
3: 46
4: 425
1090801345_1090801348 -6 Left 1090801345 11:130174456-130174478 CCAGTGTTGCTCTCCTGGGCCCT 0: 1
1: 0
2: 0
3: 22
4: 296
Right 1090801348 11:130174473-130174495 GGCCCTCTGCTGCTTCTCCTGGG 0: 1
1: 0
2: 3
3: 46
4: 425
1090801340_1090801348 17 Left 1090801340 11:130174433-130174455 CCCAAATCTATCTGACTCCAAAT 0: 1
1: 4
2: 24
3: 161
4: 849
Right 1090801348 11:130174473-130174495 GGCCCTCTGCTGCTTCTCCTGGG 0: 1
1: 0
2: 3
3: 46
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090801348 Original CRISPR GGCCCTCTGCTGCTTCTCCT GGG Intronic
900662004 1:3789473-3789495 TCGCCTCTGCTGCTGCTCCTGGG - Intronic
900802723 1:4747347-4747369 CGGCCTCTGTTGCCTCTCCTGGG + Intronic
901202031 1:7472526-7472548 TGCCCTCCGCTGCCTCCCCTGGG + Intronic
901447394 1:9316716-9316738 GGACCACGGCTGCTTCTCCAGGG + Intronic
901684749 1:10937636-10937658 GGGCCTCTTCTGCTCCCCCTGGG - Intergenic
902089706 1:13893308-13893330 GGCCCGGGGCTGCTTCTCCTGGG - Intergenic
902585314 1:17435553-17435575 AGCCCTCTGCCCCTTGTCCTGGG - Intronic
903257708 1:22114016-22114038 GGGCCTCAGTTCCTTCTCCTGGG + Intergenic
903282170 1:22256219-22256241 GGCCCCTTGCAGCTTCTCCCAGG + Intergenic
903377464 1:22875924-22875946 GGCCCTATGGTGTTTCTGCTTGG - Intronic
904093354 1:27960033-27960055 CGCCCTCTCCTGCTCCTCCGCGG - Exonic
904493698 1:30875332-30875354 GGCCCTGTGCACCTTCTCCTGGG + Intronic
905453304 1:38070903-38070925 GTCCCTCTCCTGCTCCTCATAGG - Intergenic
905584483 1:39105841-39105863 GGCCCTGAGCTGCTGCTTCTCGG + Intronic
905916034 1:41685015-41685037 GGGCCTCTTCTCCTTCTCCCTGG + Intronic
906103774 1:43279585-43279607 GGCCCTTACCTTCTTCTCCTGGG + Intergenic
906231646 1:44169659-44169681 GGCCCTATGCTGCAGCTGCTTGG + Intergenic
906458824 1:46021976-46021998 GGCCCTCAGCTGCTTCTAAAAGG - Exonic
906667908 1:47634496-47634518 GTCCCCCTGCTGTCTCTCCTTGG - Intergenic
906876161 1:49541550-49541572 GGGCCTCAGCTGCCTCTCCGCGG + Intronic
907296536 1:53459635-53459657 GGCCGCCTCCTGCTCCTCCTCGG - Exonic
907431845 1:54416754-54416776 GGCCCTCTGCTTCTGCTCCTGGG + Intergenic
907550965 1:55304497-55304519 AGCCCTTTGCTGCTGGTCCTTGG + Intergenic
907900956 1:58741030-58741052 GGCCCTCTACTAGTTCTTCTAGG + Intergenic
910100016 1:83565684-83565706 GGCCCTCTCCTGGTTCTCTGTGG + Intergenic
910112053 1:83693250-83693272 GGCTCTGTGTGGCTTCTCCTTGG - Intergenic
910584554 1:88865165-88865187 TGCCCTTTGCTGCTTAGCCTTGG + Intronic
912208984 1:107537969-107537991 CTGGCTCTGCTGCTTCTCCTGGG + Intergenic
912457787 1:109809237-109809259 GGCCCGCTGGTGCCTTTCCTGGG - Intergenic
912889153 1:113509790-113509812 GGCTCTCACCTCCTTCTCCTAGG - Intronic
915037692 1:152942550-152942572 GCTGCCCTGCTGCTTCTCCTGGG + Intergenic
915687236 1:157645667-157645689 TCCCCTCTGTTTCTTCTCCTTGG - Intergenic
918294654 1:183144934-183144956 TTCACTCTGCTGCTTCTCCCAGG + Exonic
920954258 1:210603100-210603122 GGCCTTCTGCTGCCTTTGCTCGG + Intronic
921273404 1:213492272-213492294 GCCCATCTGCTGCTTTTCCTTGG + Intergenic
921872145 1:220152603-220152625 AGCTGGCTGCTGCTTCTCCTTGG + Intronic
923744391 1:236686777-236686799 CTTCCTCTGCTGCTTCTCCCAGG - Exonic
924615040 1:245605700-245605722 GGCCCCTTGCTGCTTCCCCTGGG - Intronic
1064023415 10:11827487-11827509 AGGCTGCTGCTGCTTCTCCTCGG + Intronic
1064657218 10:17568226-17568248 CGTAATCTGCTGCTTCTCCTCGG - Intergenic
1065528281 10:26643832-26643854 GGCCCTCTTCTTCTTTTCTTAGG + Intergenic
1065558957 10:26943710-26943732 GGCCCTCTTCTTCTTTTCTTAGG - Intergenic
1065559255 10:26945986-26946008 GGCCCTCTTCTTCTTTTCCTAGG - Intergenic
1066167837 10:32807783-32807805 GGCACTATGCTGCATCTGCTTGG - Intronic
1066480291 10:35789100-35789122 GCCCCTTTGCTGCCTCTGCTGGG + Intergenic
1066501588 10:36000342-36000364 GGCCCATTGTTGCTTGTCCTTGG - Intergenic
1066575495 10:36820148-36820170 GGGCCTCAGCTGCTTCCCCGCGG + Intergenic
1066629440 10:37444670-37444692 GGCCCATTGTTGCTTGTCCTGGG - Intergenic
1067038468 10:42935593-42935615 TGCACCCAGCTGCTTCTCCTGGG + Intergenic
1067229273 10:44395525-44395547 TGCCCTCAGCTGCTCCTGCTGGG - Intergenic
1067840188 10:49669560-49669582 GGCTCTGTTCTGCTTCACCTTGG - Intergenic
1069616103 10:69807051-69807073 GACCCTCCTCTGCTTCCCCTTGG - Intronic
1069869016 10:71521846-71521868 GGCCCTCTGCCTCTTGACCTTGG + Intronic
1071231637 10:83594789-83594811 TGCCTTCTACTGCTTCTCCATGG - Intergenic
1071531295 10:86391986-86392008 TTCCCTCTGCTCCCTCTCCTGGG - Intergenic
1071963763 10:90832321-90832343 GGGCCTTAGCTGCCTCTCCTCGG - Intronic
1072805199 10:98419555-98419577 GGCCCTGCACTGCTTCTTCTGGG - Intronic
1073200681 10:101732722-101732744 GGCTCCGTGCTGCTTCTGCTTGG + Intergenic
1073349981 10:102812792-102812814 GGTCTTGTGCTGCTTCTGCTGGG - Exonic
1073540094 10:104311001-104311023 CACCTTCTGCTGCCTCTCCTAGG + Exonic
1073562827 10:104511367-104511389 GGCCCTATCCAGCTTCCCCTTGG - Intergenic
1073631252 10:105151594-105151616 GGACCTCTGAAGCTTCTTCTTGG + Intronic
1073640255 10:105245271-105245293 GTCATTCTGCTCCTTCTCCTGGG - Intronic
1074085138 10:110204093-110204115 GGCTCACAGCTCCTTCTCCTTGG - Intergenic
1074544962 10:114395153-114395175 AGCCCTCTGTGGCTTCTGCTTGG - Intronic
1074772002 10:116741105-116741127 GGCTCTCCGCTGCCTCTCCCTGG + Intronic
1075185575 10:120253539-120253561 GGCACTCTGCTCCTTGCCCTAGG + Intergenic
1075633407 10:124014996-124015018 GGCGCTCGGCTGCTTCTCCCGGG + Intronic
1076042226 10:127260001-127260023 GACCCTGTCCAGCTTCTCCTGGG + Intronic
1076180834 10:128405842-128405864 CCCCCTCTGCAGTTTCTCCTCGG + Intergenic
1076412201 10:130260072-130260094 GGCTCTTGGCTGCTTCTCCGGGG + Intergenic
1076885758 10:133261731-133261753 GGCCATTCGCCGCTTCTCCTGGG + Intergenic
1076941694 10:133614452-133614474 GGTTCACTGCTGCTTCTACTGGG + Intergenic
1077151265 11:1074136-1074158 GGCCGTCTGCCCCTTCTCCTGGG - Intergenic
1078376983 11:10803998-10804020 GGCTCTCTGTTCCTCCTCCTCGG + Exonic
1079271027 11:18986370-18986392 GGCCCTCTCCCTTTTCTCCTAGG + Intergenic
1079379435 11:19924466-19924488 GGGCCTCTTCTGCTTCCTCTGGG + Intronic
1079465863 11:20730300-20730322 GGCTCACTGATGCTTCTCCATGG - Intronic
1081685258 11:45037958-45037980 GTTCCTCTGCTGTTTCTGCTGGG - Intergenic
1082053293 11:47790821-47790843 GGAACTCTTCTGCTGCTCCTTGG + Intronic
1082125901 11:48430567-48430589 GGACCTCAGCTGCTTCTAATCGG + Intergenic
1082888776 11:58116080-58116102 GGCCCTGGGCTGCCTATCCTCGG - Intronic
1083056669 11:59828060-59828082 GGCCCACACCTCCTTCTCCTAGG + Intergenic
1083261064 11:61523422-61523444 GTCCATCTGCTGATTCTCCCAGG - Intronic
1083613846 11:64016890-64016912 GCCCCTCTGCAGCCTGTCCTGGG - Intronic
1083736381 11:64683836-64683858 GACCCTCGGCTGCTTCTTCCTGG - Intronic
1083808526 11:65089087-65089109 GAGACTCTGCTGCTTTTCCTGGG - Exonic
1085767389 11:79295062-79295084 GTACCTCTGCTGCTTCTCAGAGG - Intronic
1086773548 11:90799626-90799648 GGCTCACTGCAGCCTCTCCTGGG - Intergenic
1087060342 11:93971113-93971135 GTCCCCCAGATGCTTCTCCTAGG - Intergenic
1087968553 11:104450846-104450868 GGCCCTCTGGTGTTTGTACTTGG - Intergenic
1088578941 11:111298589-111298611 GTAACTCGGCTGCTTCTCCTAGG + Intronic
1089104421 11:115990314-115990336 GGCGCTCTGCTGGAGCTCCTTGG + Intergenic
1089121640 11:116139822-116139844 AGCCCTGAGCTCCTTCTCCTGGG + Intergenic
1090240875 11:125180770-125180792 AGATCTCTGCTGCTGCTCCTTGG + Intronic
1090402512 11:126458156-126458178 GGCCCTGGGCTGCATCTTCTGGG + Intronic
1090801348 11:130174473-130174495 GGCCCTCTGCTGCTTCTCCTGGG + Intronic
1090939691 11:131376097-131376119 GGCTCTCCCCTCCTTCTCCTAGG - Intronic
1091765474 12:3117498-3117520 GTCCCTCTGCTGCTGCCCGTGGG + Intronic
1092275896 12:7060779-7060801 GGCCCTGTGCTGCTGTCCCTGGG + Intronic
1092347923 12:7731580-7731602 GGCCCTTTGTGGCTACTCCTGGG - Intronic
1092406448 12:8224755-8224777 GGCCCTCCGCTGCTTCTGGAGGG + Exonic
1094329063 12:29273005-29273027 GGGTCCCTGCTCCTTCTCCTGGG + Intronic
1094698211 12:32842587-32842609 GCCCCTCTTCTCCTTTTCCTGGG - Intronic
1095719043 12:45380498-45380520 AGACCTGTGCTGCTTCTGCTAGG + Intronic
1096220458 12:49825760-49825782 TTCCCTCTGCTGGCTCTCCTGGG - Intronic
1097603915 12:61729927-61729949 GGCACTCTTCCCCTTCTCCTAGG + Intronic
1097685803 12:62689806-62689828 GACCCTCTGCTTATACTCCTAGG - Exonic
1098275121 12:68805145-68805167 GGGTTTCTCCTGCTTCTCCTCGG + Intergenic
1100809531 12:98324884-98324906 GGCCCACTGCTGCCATTCCTGGG - Intergenic
1101639878 12:106580455-106580477 GGCCCAGCGCTGCTTCACCTGGG - Intronic
1102598037 12:114007779-114007801 AGCCCCCTGCTTCTACTCCTGGG + Intergenic
1102721697 12:115022146-115022168 TGCTCTCTGCTTCATCTCCTGGG + Intergenic
1102738611 12:115185881-115185903 GGCCGGCAGCTGCATCTCCTGGG + Intergenic
1102909673 12:116703321-116703343 AGCCGTCTGTTGCTTCTCCAAGG - Intergenic
1104829721 12:131741880-131741902 TTCCCTCCGCTGCTTTTCCTGGG + Intronic
1104884072 12:132094629-132094651 ATGCCTCTGCTGCTTGTCCTGGG + Intronic
1105706540 13:22971013-22971035 GGCCTTCTGCTTCATCTCCTTGG + Intergenic
1105707760 13:22978963-22978985 GCCAAGCTGCTGCTTCTCCTGGG - Intergenic
1108424832 13:50289174-50289196 GGGCCTCTGCTGGTTCACCAGGG - Intronic
1109336600 13:61002975-61002997 GGCCCTCTGTAACTTCTACTTGG + Intergenic
1110364122 13:74662210-74662232 GCCCCTCTGCTGGGTCCCCTTGG + Intergenic
1111629580 13:90832804-90832826 GGACCTCTGCTAATTCTACTTGG + Intergenic
1112190627 13:97173900-97173922 GGCCCTCTTCTGCATTTCCATGG + Intergenic
1112583277 13:100694805-100694827 TTCCCTCTGCTTCTTCTCCACGG + Intergenic
1112695318 13:101941565-101941587 GGCCCTCTGCTGCCTGTTTTTGG + Intronic
1116182560 14:41553759-41553781 GTCCCTGTGCTGCTTTGCCTAGG - Intergenic
1117860915 14:60091967-60091989 TCCCCGCTGCTGCTTCTGCTAGG + Exonic
1117958598 14:61141931-61141953 TGCCCTCTGCTCATTCTCTTTGG - Intergenic
1118815878 14:69313498-69313520 GGCCCACTGCTTATTCCCCTAGG - Intronic
1118842074 14:69520956-69520978 GGCATTCTGATGCTCCTCCTGGG - Intronic
1119445925 14:74663327-74663349 CTCCCTCTGCTGATACTCCTTGG - Exonic
1120080908 14:80215207-80215229 TGCCCTAGGCTGCTTCTCTTTGG - Intronic
1121124313 14:91396105-91396127 GATTCTCTGCTGCTTCGCCTTGG - Intronic
1121174078 14:91877424-91877446 GGCCTTGTGCTGTCTCTCCTAGG - Intronic
1121336192 14:93078838-93078860 GGTCCTCTGCTGTGTGTCCTGGG - Intronic
1122148282 14:99707130-99707152 GGCCCACTGCTGAGTCTACTGGG - Intronic
1122229133 14:100296517-100296539 GGCCATGTTCTGTTTCTCCTGGG + Intronic
1122478965 14:102033339-102033361 GGCCTTCTGCTGGTTGTCCTTGG - Exonic
1122980585 14:105190812-105190834 CGACCTCTGCTGCTGCTCCCGGG - Intergenic
1124365937 15:29071715-29071737 GGGCTTGTGATGCTTCTCCTTGG - Intronic
1124666169 15:31594784-31594806 CACCCTCATCTGCTTCTCCTGGG - Intronic
1125510234 15:40288790-40288812 GGCCCTCTCAGGCTTGTCCTTGG + Exonic
1126105082 15:45142090-45142112 GACCCTCTGTTGCTTCCCTTTGG + Exonic
1126230266 15:46315458-46315480 GCCTCTCTGCTGCTTCCCCAAGG - Intergenic
1127233714 15:57024292-57024314 GGCTCACTGCAGCTTCTGCTAGG + Intronic
1127761978 15:62148395-62148417 GGCCCCCATCTGCTTCTTCTTGG + Intergenic
1128554743 15:68623694-68623716 CACCCGCTGCTGCTGCTCCTGGG - Intronic
1129296784 15:74604233-74604255 AGCCCACTGTGGCTTCTCCTGGG - Intronic
1129566014 15:76624711-76624733 GGCCCACTGCTGCCACTACTGGG - Intronic
1131056636 15:89378903-89378925 GGCCCGCGGCTGTTTCCCCTCGG + Intergenic
1131107546 15:89745135-89745157 GGCTCCCTGCTGCCTCTGCTGGG - Intergenic
1132806994 16:1779438-1779460 GGTCCCCTGTGGCTTCTCCTGGG - Intronic
1132938810 16:2496808-2496830 GCCCCTCTGCTACTTCGCCCGGG + Exonic
1133184442 16:4085550-4085572 GACCCTCTGCTGCAGCTCTTGGG - Intronic
1133286999 16:4695127-4695149 GGCCTTCTTCTGCTTCTCGGTGG - Exonic
1133631808 16:7629148-7629170 GGCCCTGGGCTGCTTCTCCCTGG + Intronic
1133852496 16:9518594-9518616 GGCCCTATGCTGTGTCACCTTGG - Intergenic
1134008982 16:10837241-10837263 TGCACTGTGCTGCTTCTCCCAGG + Intergenic
1134225002 16:12382831-12382853 GGCCTTCTCCTGCTTCTCTCTGG + Intronic
1134628777 16:15741799-15741821 TGCCTTCTGCTGCCGCTCCTTGG + Exonic
1136170767 16:28487805-28487827 GGCCAGCTCCTGCCTCTCCTTGG - Intronic
1137442528 16:48508906-48508928 GGGCCTTAGCTGCCTCTCCTCGG + Intergenic
1138457892 16:57131831-57131853 AGCCCGCTGCTCCCTCTCCTGGG + Intronic
1141592581 16:85078432-85078454 AGCCCTGGGCCGCTTCTCCTGGG - Exonic
1141606470 16:85156768-85156790 GGCCCTCTGCTGCTCCGCAAAGG + Intergenic
1141827683 16:86492725-86492747 GGCCCTCTGTTTCTTCTTCTGGG - Intergenic
1141839924 16:86567856-86567878 GGCCCGCTCCTCCTTCTCCTTGG - Exonic
1142092308 16:88221074-88221096 GCCCTTCTGCTGCTCCTACTCGG + Intergenic
1142197490 16:88745456-88745478 GGCCCCCTGCACCTTCTTCTGGG - Intronic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1142973029 17:3625630-3625652 AGCCCACTGCTGCTTCTGCATGG - Intronic
1142979705 17:3664469-3664491 GGCCGCCTCCTGCTCCTCCTGGG + Intronic
1143317612 17:6044418-6044440 GTCCCTCTCCTGGTTCACCTGGG + Intronic
1143318704 17:6053530-6053552 GGTACCCTGCTACTTCTCCTAGG - Intronic
1143768413 17:9152430-9152452 GCCCCTCTGATGGTTCCCCTGGG + Intronic
1143854629 17:9839552-9839574 CACCCTCTGCTGCTTCTCCATGG + Intronic
1144042487 17:11425176-11425198 GTCCTTCTCTTGCTTCTCCTTGG - Intronic
1144738058 17:17565935-17565957 CTCCCGCAGCTGCTTCTCCTTGG + Intronic
1145222129 17:21098098-21098120 GGCTCACTGCTACCTCTCCTGGG + Intergenic
1146832463 17:36081761-36081783 AGGCATCTGCTGCTTTTCCTAGG - Intergenic
1146846943 17:36188078-36188100 AGGCATCTGCTGCTTTTCCTAGG - Intronic
1148157089 17:45430757-45430779 GACCCTCTGCTGATTCTCTGCGG - Intronic
1149218011 17:54380945-54380967 GGCCCTCTGCTTCATCTCACGGG + Intergenic
1149350183 17:55778890-55778912 GACCCTCTGCTGGAACTCCTCGG - Intronic
1150793959 17:68222999-68223021 GCCTCTCTGCTGCTCCTACTTGG - Intergenic
1151671261 17:75572943-75572965 TGCCCTGTGCTGCTGCTGCTGGG - Intronic
1153474943 18:5489052-5489074 GGCCTGCTGCTGCTCCTCCTTGG + Exonic
1153893244 18:9537166-9537188 GGCTCTCACCTCCTTCTCCTAGG + Exonic
1154208887 18:12361978-12362000 GGCACTATGCTGCTGGTCCTGGG - Intronic
1155154119 18:23144040-23144062 GGCACTCTCAGGCTTCTCCTGGG + Intronic
1155705414 18:28804569-28804591 GGGCATCTGCTTCTGCTCCTGGG + Intergenic
1156516885 18:37687746-37687768 TGCCCTTTGATGATTCTCCTTGG + Intergenic
1156543191 18:37937478-37937500 GGCCCTCTGCTCTATCTCCCCGG + Intergenic
1156989392 18:43389160-43389182 TATTCTCTGCTGCTTCTCCTCGG + Intergenic
1157328670 18:46687441-46687463 GTCCATAGGCTGCTTCTCCTTGG + Intronic
1158862545 18:61606793-61606815 GCCCCTCTGCTGCACCCCCTTGG + Intergenic
1160041509 18:75349814-75349836 GGCTCGCTGCTGCTCCTGCTGGG - Intergenic
1160944108 19:1633222-1633244 GGCCCGCTCCTGCTTCTCCACGG - Intronic
1161600234 19:5177724-5177746 TGCCCTGTGCTCCTTCTCCAGGG - Intronic
1163177374 19:15573716-15573738 GGCCCTTGGCTGCCTCTACTAGG + Intergenic
1163647975 19:18501091-18501113 GGCCCGCTCGTTCTTCTCCTGGG - Intronic
1164510002 19:28889184-28889206 GGGCTTCTGCTGCTTCTCCTGGG - Intergenic
1164826168 19:31286581-31286603 AGCCCTCTGCTGCAACCCCTCGG + Intronic
1165120349 19:33554968-33554990 GGACCTCTGCTGAGGCTCCTGGG - Intergenic
1165622371 19:37259025-37259047 GTCCCCCTGCTGAATCTCCTGGG + Intergenic
1165816377 19:38645002-38645024 GGCTCCCTCCAGCTTCTCCTGGG + Intergenic
1166331025 19:42078096-42078118 TGGCCTCTGCTCCTTCTCCCAGG - Intronic
1167129213 19:47573291-47573313 CGCTCTCGGCTGCTTCTCCGAGG + Intergenic
1167468131 19:49660928-49660950 GGCCCTCTGCTGCCTCGACCAGG + Intronic
1167577387 19:50324313-50324335 GCCCATCTGCTGCGTCTGCTGGG - Intronic
1167790759 19:51678133-51678155 TTCCCACTGCTGCTTGTCCTTGG + Intergenic
1168101449 19:54143588-54143610 GGCCCACAGCTCCTTCTCCCTGG - Intronic
1168146880 19:54424575-54424597 GGGCCTCAGCTCCTTCTCCTGGG + Intronic
1168232927 19:55044823-55044845 GGCCATCTGATGCTTCCCCTGGG - Exonic
1168406033 19:56111213-56111235 GCCCCTCTGCTGTGCCTCCTTGG - Intronic
925059958 2:883450-883472 AGCCCTCTGCTGCTCCCCCTGGG - Intergenic
925308793 2:2867400-2867422 GGTCTTCTGCTGCAGCTCCTCGG + Intergenic
925426324 2:3751502-3751524 GACAAGCTGCTGCTTCTCCTGGG - Intronic
926217385 2:10913868-10913890 GGTCCTGTGGTGCTTCTCCTCGG - Exonic
926800515 2:16656105-16656127 TGCCCTCTGCAGCTCTTCCTTGG + Intronic
927520081 2:23693263-23693285 GGCCGTCAGCTGCTTCTCTGGGG - Exonic
928028933 2:27762465-27762487 GTGCCTCTGCAGCTTCTCCAGGG - Intergenic
929600089 2:43199445-43199467 GGGTCTCTGCTTCTTTTCCTTGG - Intergenic
931182557 2:59917336-59917358 GGCCCCCTTCTTCTCCTCCTGGG - Intergenic
933836696 2:86251604-86251626 TGCCCTCTTCTGTTTCTCCCAGG + Intronic
934558577 2:95300492-95300514 TCCCCTCTTCTGCTTCACCTTGG - Intronic
935150301 2:100427853-100427875 GGCGCTCTCCTCCTCCTCCTAGG + Intergenic
935424706 2:102907825-102907847 AGCCACCTGCTGCTTCTCCAGGG + Intergenic
935918827 2:107986967-107986989 GGCCCCCTGCGGCCTTTCCTCGG - Intronic
937279783 2:120709849-120709871 GTCCCTGTCCTGATTCTCCTAGG + Intergenic
938146009 2:128835442-128835464 GCCCCTCTCCTGCTGCTGCTTGG + Intergenic
938241020 2:129742365-129742387 GGCCCACTGCAGCCTCGCCTGGG + Intergenic
938502310 2:131836424-131836446 GGCTCTCTGCTGCTGCTGATGGG + Intergenic
939042136 2:137202528-137202550 TGCTCTCTACTGCTGCTCCTGGG - Intronic
943881644 2:193153142-193153164 GTCACTCTGCTGCTGCTACTAGG + Intergenic
943993455 2:194728993-194729015 GAACCTCTGCTGCATCTTCTAGG - Intergenic
944933347 2:204543491-204543513 TGGCCTCTGCTGCATCCCCTAGG + Intergenic
945840265 2:214879500-214879522 GGTCCTCTGCTGTTTCCCCTGGG - Intergenic
946202193 2:218076812-218076834 CTCCCTCTGCTGCCTCCCCTGGG + Intronic
948157954 2:235799902-235799924 GGCCCTCTTCTTCTTCTGCTGGG + Intronic
948186829 2:236027695-236027717 GGCCATCTTGTGCTTCTCCAGGG + Intronic
948307807 2:236962690-236962712 GACCATCTCCTGCTCCTCCTAGG - Intergenic
948353278 2:237358126-237358148 GGCTCACTCCTGCTTATCCTTGG + Intronic
948473869 2:238203878-238203900 GGGCCCCTCCTGCTTTTCCTTGG + Intergenic
1168841080 20:910636-910658 GACCTTCTTCTCCTTCTCCTTGG - Intronic
1169068596 20:2708116-2708138 TGCTCTCTGCTGCTGCTCCCTGG + Intronic
1169329541 20:4705718-4705740 GGCCCTATGTGGCTTCTCCAAGG + Intergenic
1170185598 20:13586524-13586546 GGACCCCTTATGCTTCTCCTTGG - Intronic
1170945764 20:20889739-20889761 TGCCCTCTGCTGCTCCTCCACGG + Intergenic
1171096215 20:22334630-22334652 GGCCCCCAGCTGATTCTCCAGGG - Intergenic
1171114719 20:22515428-22515450 GGGCCTTTGCTCCTTCTCCCAGG - Intergenic
1171480650 20:25453538-25453560 GGCGCCTCGCTGCTTCTCCTCGG + Exonic
1172098557 20:32472671-32472693 TGGCCTCTGCTGCCTCTTCTGGG - Intronic
1172199259 20:33113740-33113762 GGCCATCTGCTGGTTTTCCCTGG + Intergenic
1172645967 20:36469837-36469859 GGCCATCTGCTCCTTCTCCCTGG + Intronic
1173426155 20:42945429-42945451 GGGCGTCTGCTGTTTCTCCCGGG + Intronic
1174328775 20:49801240-49801262 AGCCCTTCGTTGCTTCTCCTGGG - Intergenic
1174679922 20:52396441-52396463 GCCCCTCTGATTCTTCACCTAGG + Intergenic
1175336507 20:58199680-58199702 GGCCCTCTGCTGTGTCCCCTAGG - Intergenic
1175388089 20:58610155-58610177 GGCCCCTAACTGCTTCTCCTGGG + Intergenic
1175495856 20:59413667-59413689 GGGCCTCTGCAGCCTGTCCTTGG + Intergenic
1176113721 20:63422148-63422170 GCCCCTCTGCTGCCTGACCTGGG - Intronic
1176146714 20:63568716-63568738 GGCCCGCTGCTGCTTGGCCCTGG - Exonic
1178707574 21:34888543-34888565 CAACCTCTGCTGCTTCTCCTTGG - Intronic
1178763087 21:35422666-35422688 GGACCTCTGCCTCTTCTCCTAGG - Intronic
1179443421 21:41411985-41412007 GGCGCTCTCCCCCTTCTCCTAGG - Intergenic
1180031040 21:45208215-45208237 GGCACCCTGCTCCTTCTTCTTGG - Intronic
1180177854 21:46098775-46098797 CTCCGTCTGCAGCTTCTCCTGGG - Intronic
1181419148 22:22785815-22785837 GGCCTGCTGCTGCTCCTGCTGGG - Intronic
1181622453 22:24100419-24100441 AGCAATCTGCTGCTTCTCCCTGG - Intronic
1181688959 22:24547757-24547779 GCCTCTCTGCTGCTGCTCCCTGG + Intronic
1181783409 22:25208809-25208831 GGCCTTCTGCAGCCTCGCCTGGG + Intergenic
1183529660 22:38346604-38346626 GGCCCTGGGCCACTTCTCCTAGG + Intronic
1183671586 22:39276051-39276073 GGCCACCTGCTGCTTCTACCTGG - Intergenic
1183821337 22:40348240-40348262 TGCCCTCTGCTGCTTTGCTTTGG + Intronic
1183970319 22:41472456-41472478 GGCACTATGCTGCTTCCCTTTGG + Intronic
1184182551 22:42840359-42840381 GGCTCTCTGCTTCTTCTCATAGG + Intronic
1185176479 22:49330182-49330204 GGTTCTCTGCTGGTTCTCCTTGG + Intergenic
949281506 3:2352607-2352629 GGGCCTCTGCTGCCTCCCCTTGG + Intronic
949302768 3:2603926-2603948 GGCCCTCTGCCAATTCACCTTGG - Intronic
949547236 3:5082626-5082648 GACCTGCTGCTGCTCCTCCTGGG + Intergenic
960557351 3:119043846-119043868 GGTACTCTCCTGCTTCCCCTAGG - Intronic
960995158 3:123335798-123335820 TGCCCTCCTGTGCTTCTCCTGGG - Intronic
961002083 3:123380682-123380704 GTGCCTCAGCTGCCTCTCCTGGG + Intronic
962309345 3:134314191-134314213 GTCACTCTGCAGCTTCTCCCAGG - Intergenic
962579363 3:136783906-136783928 TGCCCTCTGCTACTTCTCCTTGG - Intergenic
963050962 3:141143321-141143343 GGTACTCTCCTGCTTCCCCTAGG + Intronic
963971113 3:151430324-151430346 GGCCGTCTGCTGCTGCTGCTGGG - Exonic
965921956 3:173927837-173927859 GGCCCTCTGCAGCTGCTCTCGGG - Intronic
966135383 3:176692385-176692407 AGCCCTCTGCAGCTTGTCCACGG + Intergenic
966474362 3:180326285-180326307 GGCCCTCTCCTCCTCCTCTTAGG + Intergenic
966803266 3:183784718-183784740 GGACCTCTGTTGCAACTCCTCGG - Intronic
967010653 3:185430122-185430144 GGCTCTCTGCAGCCTCTGCTGGG - Intronic
967289174 3:187902448-187902470 AGCCCTCTGGCCCTTCTCCTTGG + Intergenic
968068911 3:195773956-195773978 GGCCCACCGCTGCTTCTGCGGGG - Intronic
968135160 3:196215511-196215533 GACCCTCTGCACCCTCTCCTGGG + Intronic
968222059 3:196947022-196947044 CTCCCACTGCTGCCTCTCCTGGG - Exonic
968309861 3:197674508-197674530 TATTCTCTGCTGCTTCTCCTCGG + Intronic
968503211 4:960680-960702 GGCCCTCCTCGGCTTCTGCTTGG + Exonic
968525079 4:1052611-1052633 GGCCCTGCGCTGCTGTTCCTGGG + Intergenic
968576277 4:1367707-1367729 GGTCCTGCGCTGCTTCTCCAGGG + Intronic
968962076 4:3750720-3750742 GGCCATTTGCTGTGTCTCCTGGG + Intergenic
969112475 4:4852457-4852479 GGCCTGCTGCTGCCTATCCTGGG + Intergenic
969299812 4:6291302-6291324 GGCCACCTGCTTCTTCTTCTTGG - Exonic
969449355 4:7264360-7264382 GGCCCTCTCCTGCTTGTCCAGGG + Intronic
969601307 4:8178050-8178072 GGGCCTCTGCTTCTGCTGCTTGG + Intergenic
971381991 4:26107593-26107615 GGCCCTCAGATGCTTCTCTTTGG + Intergenic
974916272 4:68182476-68182498 GGCGCCCTGTCGCTTCTCCTGGG - Intergenic
975296868 4:72744725-72744747 TGCCCTATCCTGCTTCTCCAGGG + Intergenic
975689496 4:76949941-76949963 GGGCCTCGCCTGCTGCTCCTCGG + Intronic
977879600 4:102188649-102188671 GGGCATCTGCTGCTCCACCTTGG - Intergenic
980543024 4:134219229-134219251 GGCTCACTGCTGCCTCACCTAGG + Intergenic
981310389 4:143292608-143292630 GGCCATTTTCTACTTCTCCTGGG - Intergenic
982800210 4:159697102-159697124 GGTGCTCTCCTGCTTCTCCTAGG + Intergenic
984707179 4:182856063-182856085 TGCTCTCTGCTGCTCCTCCAAGG - Intergenic
985543683 5:498791-498813 TGGCCTCGGCTGCCTCTCCTGGG + Intronic
985599758 5:821159-821181 GGCTCTCTGCTGCTCCCCCCGGG + Intronic
985789273 5:1916502-1916524 GCCCCTCTGCTGTCCCTCCTCGG + Intergenic
987757374 5:22113921-22113943 GGCCCTCCACTGCTTCTGATTGG - Intronic
988910419 5:35835117-35835139 GCCCCTCTGCTGCATTTCCATGG - Intergenic
990738022 5:58885474-58885496 GGCCTTTTGCTGCTTTTCCGAGG + Intergenic
990745805 5:58958681-58958703 TGCCCACCGCTGCTTCCCCTGGG + Intergenic
991483917 5:67114113-67114135 GGCCTTCTGCTGCTTCCAATAGG - Exonic
993899744 5:93577148-93577170 TTCCTCCTGCTGCTTCTCCTGGG + Intergenic
994646075 5:102470666-102470688 GGTGCTCTCCTGCTTCCCCTAGG + Intronic
995988417 5:118208091-118208113 GGGCCTCCGCTGCCTCTCCGTGG - Intergenic
996702161 5:126461212-126461234 GGCCCTTTGCCGCTCCTGCTGGG - Intronic
996778886 5:127161195-127161217 GGACCTCAGCTGCTTCTAATCGG + Intergenic
996796388 5:127352912-127352934 GGCCTCCTGCTGCTGCTGCTGGG - Intronic
997199884 5:132003495-132003517 GGCCCTCCCCTGCCGCTCCTGGG - Intronic
997241981 5:132314385-132314407 GGCCCTCAGCAGCTTTTCCTGGG + Intronic
997474474 5:134134599-134134621 GGCCCTTGGCTCCTTCTCCCTGG + Intronic
998168210 5:139856438-139856460 TACCCTCTGCTGCTGCTGCTGGG + Intronic
998172642 5:139881503-139881525 GGCACTCTGTGGCTTCTCCAAGG + Intronic
998392363 5:141795508-141795530 GGACCTTTTCTGCTCCTCCTGGG + Intergenic
999325257 5:150639818-150639840 GGGCCTCTACTGCTTCACTTCGG - Intronic
999785669 5:154888279-154888301 GGCCTGCTGCTGCATTTCCTGGG + Exonic
1001933122 5:175687110-175687132 AGCCCTCTGCCCCTGCTCCTGGG - Intergenic
1002198921 5:177516156-177516178 TTCCTTCAGCTGCTTCTCCTTGG + Exonic
1002339531 5:178505916-178505938 GGCCCTTTGTGTCTTCTCCTTGG - Intronic
1002683039 5:180983391-180983413 GGACCTCTTGTGCTTCTGCTTGG - Intergenic
1002711117 5:181195519-181195541 GGCGTCCTGCGGCTTCTCCTCGG - Exonic
1003365502 6:5471133-5471155 CGCCCTCTACTGCTGCTTCTGGG - Intronic
1004217601 6:13716969-13716991 GGGCCTCAGCTGCCTCTCCGCGG + Intergenic
1004254536 6:14050799-14050821 GGGCTTGAGCTGCTTCTCCTGGG + Intergenic
1004264294 6:14135437-14135459 AGGCCACTGCTGCTTCTCCATGG + Exonic
1004712558 6:18186147-18186169 GGCCCTCTTGTGCTTTTCTTAGG - Intronic
1004891021 6:20100622-20100644 GTCCTACTGCTGCTTCTCTTAGG - Intergenic
1005292312 6:24391912-24391934 GTCCCTCTGCTGTTTCCCTTGGG - Intergenic
1005833167 6:29687173-29687195 GGACCTCCCCTGCGTCTCCTTGG - Intergenic
1005995589 6:30929290-30929312 AGCCCCCTGCTACCTCTCCTTGG + Intergenic
1006655061 6:35583982-35584004 CGCCCCCTTGTGCTTCTCCTGGG - Intronic
1006776175 6:36594274-36594296 CGGCCTCTTCTGCTTCTCATTGG + Intergenic
1006793696 6:36719314-36719336 GTGCCTCTGCTGCTGCTCCTTGG + Intronic
1006816372 6:36853182-36853204 AGCTCTCTGCTGCTTCTCGTGGG - Intergenic
1007113172 6:39325284-39325306 TGCCCTCTGCTGCTTTATCTTGG + Intergenic
1007305095 6:40897598-40897620 GGCCCACTGCTGCCTCTGCCTGG + Intergenic
1007759531 6:44125578-44125600 AGCTCACTGCAGCTTCTCCTGGG - Intronic
1009558048 6:65200484-65200506 TGGCTTCTGCTGCCTCTCCTTGG - Intronic
1013155463 6:107489013-107489035 GGCCCTCTCCTGCCACGCCTGGG - Intergenic
1014265196 6:119269248-119269270 GGCCTTCTTCCTCTTCTCCTGGG + Intronic
1014525022 6:122492100-122492122 GGCCCTCTGCTGCCCCCTCTTGG - Intronic
1015509568 6:134024330-134024352 GGCCTTCTGAAGCTTCTGCTTGG - Intronic
1015527519 6:134187657-134187679 GGCCCATTGCTGCCTCTCTTTGG + Intronic
1015795594 6:137008041-137008063 GGCTCACTGCAGCCTCTCCTGGG + Intronic
1016021658 6:139242597-139242619 GCTCCTCTGCTGCTGCTCGTGGG + Exonic
1016943464 6:149504354-149504376 GCTCCTCTCATGCTTCTCCTGGG - Intergenic
1017425692 6:154318639-154318661 GGCTCACTGCAGCCTCTCCTGGG - Intronic
1017621711 6:156306304-156306326 GGTTCTATGCTGCTTCTCCAGGG - Intergenic
1017812018 6:157990327-157990349 TGCCTTCTTCTCCTTCTCCTTGG + Intronic
1018430034 6:163714747-163714769 TGCCCTCTCCTGAGTCTCCTGGG - Intergenic
1019048626 6:169166965-169166987 GGCCCTCTGCTGCCCTGCCTGGG - Intergenic
1019060631 6:169255027-169255049 GGGGAGCTGCTGCTTCTCCTGGG + Intergenic
1019328560 7:451817-451839 GCCCCTCTGCTGCTCCCCCAGGG + Intergenic
1019358996 7:595198-595220 AGCCCTGTGCTGCTGTTCCTCGG + Intronic
1020846971 7:13298277-13298299 GGCACTCTGCTGTTGCTCGTTGG - Intergenic
1021424699 7:20486709-20486731 GGCCCTGTGCTGCAGCTGCTTGG - Intergenic
1021754867 7:23842350-23842372 GGTGCTCTCCTCCTTCTCCTAGG + Intergenic
1022027312 7:26460579-26460601 TTCCCTCTCTTGCTTCTCCTTGG - Intergenic
1022636154 7:32137570-32137592 ACCCTTCTGCTGCTTCTCCAGGG - Intronic
1022816179 7:33916641-33916663 AGCCTGCTGCTGCTTCTTCTTGG + Intronic
1023966690 7:44966597-44966619 GACCCTCTGCTCCTACCCCTTGG + Intronic
1024088201 7:45914680-45914702 GGCCCTGAGCTGCAGCTCCTGGG + Intronic
1024604824 7:51014637-51014659 TTCCCCCTGCTGCTTCCCCTCGG + Intergenic
1026671082 7:72391234-72391256 AGCCCTCTGCAGCTTCACTTTGG - Intronic
1026929955 7:74218249-74218271 GTTCCTCTGTTGCTTCTCCCAGG + Intronic
1026953037 7:74360188-74360210 GGCTCGCTGCAGCTTCTCCTCGG - Exonic
1026973973 7:74485192-74485214 GCCCCACTGCTGCCTCCCCTGGG - Intronic
1027670661 7:81092622-81092644 GGCCCTGCCCTACTTCTCCTTGG + Intergenic
1029112013 7:98217423-98217445 GGCACTCGGCTCCTGCTCCTGGG + Exonic
1031341141 7:120603546-120603568 TGCCCTATGCTACTTCTCCCTGG - Intronic
1032395492 7:131586449-131586471 GGCCCCCTCCTGCCTCTCCTTGG - Intergenic
1033261221 7:139845467-139845489 GAGCCTCTTCTGCATCTCCTAGG + Intronic
1033462667 7:141561865-141561887 GGTGCTCTCCTGCTCCTCCTAGG + Intronic
1033581379 7:142740279-142740301 AGTCTTCTGCTCCTTCTCCTGGG + Intergenic
1033586603 7:142779129-142779151 GGTCTTGTGCTGCTTCTGCTAGG + Intergenic
1034374268 7:150628963-150628985 GGCCATCTCCTGAATCTCCTGGG + Intronic
1034489910 7:151387600-151387622 GTGCCTCTCCTGCTTCTGCTTGG - Intronic
1034562510 7:151890313-151890335 CTTCCTCTGCTCCTTCTCCTGGG + Intergenic
1035054360 7:156024229-156024251 AGCCCTCTGGTGCTTCTGCAGGG - Intergenic
1035435474 7:158856406-158856428 GGTCCTCTGCTGCTCCTGCCTGG + Intergenic
1036221993 8:6929020-6929042 GGGCCTCTGCTCTTTCTCCTGGG + Intergenic
1036263279 8:7256959-7256981 GGCCCTCCGCTGCTTCTGGAGGG - Intergenic
1036264582 8:7264581-7264603 GGCCCTCCGCTGCTTCTGGAGGG - Intergenic
1036265881 8:7272203-7272225 GGCCCTCCGCTGCTTCTGGAGGG - Intergenic
1036267183 8:7279825-7279847 GGCCCTCCGCTGCTTCTGGAGGG - Intergenic
1036268486 8:7287447-7287469 GGCCCTCCGCTGCTTCTGGAGGG - Intergenic
1036269790 8:7295069-7295091 GGCCCTCCGCTGCTTCTGGAGGG - Intergenic
1036298100 8:7551985-7552007 GGCCCTCCGCTGCTTCTGGAGGG + Intergenic
1036299405 8:7559635-7559657 GGCCCTCCGCTGCTTCTGGAGGG + Intergenic
1036300710 8:7567283-7567305 GGCCCTCCGCTGCTTCTGGAGGG + Intergenic
1036302017 8:7574929-7574951 GGCCCTCCGCTGCTTCTGGAGGG + Intergenic
1036303312 8:7582576-7582598 GGCCCTCCGCTGCTTCTGGAGGG + Intergenic
1036315323 8:7715498-7715520 GGCCCTCCGCTGCTTCTGGAGGG - Intergenic
1036316627 8:7723146-7723168 GGCCCTCCGCTGCTTCTGGAGGG - Intergenic
1036317934 8:7730794-7730816 GGCCCTCCGCTGCTTCTGGAGGG - Intergenic
1036319243 8:7738442-7738464 GGCCCTCCGCTGCTTCTGGAGGG - Intergenic
1036320550 8:7746089-7746111 GGCCCTCCGCTGCTTCTGGAGGG - Intergenic
1036321860 8:7753737-7753759 GGCCCTCCGCTGCTTCTGGAGGG - Intergenic
1036323169 8:7761385-7761407 GGCCCTCCGCTGCTTCTGGAGGG - Intergenic
1036324470 8:7769032-7769054 GGCCCTCCGCTGCTTCTGGAGGG - Intergenic
1036351564 8:8015275-8015297 GGCCCTCCGCTGCTTCTGGAGGG + Intergenic
1036352874 8:8022921-8022943 GGCCCTCCGCTGCTTCTGGAGGG + Intergenic
1036354163 8:8030569-8030591 GGCCCTCCGCTGCTTCTGGAGGG + Intergenic
1036846822 8:12175694-12175716 GGCCCTCCGCTGCTTCTGGAGGG + Intergenic
1036868187 8:12418013-12418035 GGCCCTCCGCTGCTTCTGGAGGG + Intergenic
1039490512 8:37944043-37944065 GCCCCTTTGTTGTTTCTCCTTGG + Intergenic
1039583132 8:38683077-38683099 ATCCCACTGCTGTTTCTCCTGGG + Intergenic
1039967963 8:42297572-42297594 GGCACTCTGCAGCCTCTTCTTGG - Intronic
1040565695 8:48564809-48564831 GGCACTGTGCTGCTCCTCTTGGG + Intergenic
1040861928 8:52008163-52008185 GGCCCTTTGCTCCTCTTCCTGGG - Intergenic
1041254201 8:55965343-55965365 GGGCACCTGCTGCATCTCCTGGG + Intronic
1044216407 8:89616281-89616303 GTCCATCTGCTGCTTCTCTTTGG - Intergenic
1044729615 8:95219466-95219488 GGCCCTCTCCTCCTTCTCACTGG + Intergenic
1046782436 8:118230083-118230105 CTCCCTCTCCTCCTTCTCCTTGG - Intronic
1047406904 8:124593101-124593123 CGCCCTCTGCTGGCTCTCCCTGG - Intronic
1047924757 8:129671879-129671901 TCCCCACTGCTGCTTGTCCTTGG - Intergenic
1047952174 8:129943976-129943998 GGCCCCCTGCGTTTTCTCCTTGG - Intronic
1048862015 8:138730504-138730526 AGCCCTCTGATGCTTTTCCCGGG - Intronic
1049053948 8:140220349-140220371 GGGCCTTTGCTGCCTCTGCTGGG + Intronic
1049246416 8:141565180-141565202 GCCCCTCAGCTGCAGCTCCTGGG - Intergenic
1049267660 8:141677717-141677739 GGCTTTCTCCTGCTCCTCCTGGG + Intergenic
1049514724 8:143047971-143047993 TGCTCTGTGCTGCATCTCCTTGG + Intronic
1049910854 9:266317-266339 GGCTCTCTGTTGCTGTTCCTGGG - Intronic
1049998580 9:1052726-1052748 GGGTCTCTGCTGCTTCCCATCGG + Intronic
1051707326 9:19894246-19894268 GGCACTCTGCCTCCTCTCCTTGG - Intergenic
1054330776 9:63753457-63753479 CTCCCTCTGATGCTTCTACTGGG + Intergenic
1055369474 9:75581667-75581689 GGCTCTCTACTGGGTCTCCTGGG + Intergenic
1055688900 9:78808776-78808798 CTCTCTCTGCTGCTTTTCCTTGG + Intergenic
1055781859 9:79829246-79829268 GCCACTCTGCTCCTTCTCCTGGG + Intergenic
1057129515 9:92643295-92643317 TGCCCTGTGCTACTTCTTCTAGG - Intronic
1057269937 9:93645025-93645047 GCCCCTCTGCTGCTTCCTCTGGG + Intronic
1058751417 9:108041914-108041936 GGTCATCTGCTGCTCATCCTCGG + Intergenic
1060728883 9:126024776-126024798 GTGCCTCAGCTGCTCCTCCTTGG + Intergenic
1061033750 9:128102223-128102245 AGCCCCCTGCTCTTTCTCCTGGG + Intronic
1061115096 9:128605304-128605326 GGCGCTCTGCTGTTTCACCAAGG - Exonic
1061570494 9:131475050-131475072 GGGGCTCTGCTCCTTCTCCTTGG - Exonic
1061620925 9:131810749-131810771 GGCCATCACCTGCTTCTCCTAGG + Intergenic
1062287184 9:135778445-135778467 AGCCATCTGCTGCTTCCCCATGG + Exonic
1062497129 9:136837255-136837277 GGCTCTCTGCTGCTGCTGCTGGG - Intronic
1185940135 X:4308648-4308670 AGGCCTCTGATCCTTCTCCTAGG - Intergenic
1186424980 X:9456956-9456978 GGCCGGCTTCTGCATCTCCTAGG + Intergenic
1187460868 X:19485652-19485674 GGCCCTTTTCTCCCTCTCCTAGG + Intronic
1187542018 X:20206111-20206133 GGACCGCTGCTGCTCCTGCTGGG - Intronic
1188328479 X:28837594-28837616 AAGCCTCTCCTGCTTCTCCTGGG - Intronic
1188445720 X:30251088-30251110 GGGCTTCTGATGCCTCTCCTGGG + Exonic
1190566018 X:51731519-51731541 GGCCATCTGCTGCTGCTGGTTGG + Intergenic
1192436015 X:71144406-71144428 TCCCTTCTGCTGCTTCTGCTGGG - Intergenic
1193837545 X:86363908-86363930 TATCCTCTGCTGCTGCTCCTGGG + Intronic
1194264117 X:91734274-91734296 GGACCTCAGCTGCTTCTAATTGG + Intergenic
1197760015 X:130021329-130021351 GGGCCCCTTCTGCTCCTCCTGGG + Intronic
1197899695 X:131356951-131356973 GGCCCACTGCAGCTGCTGCTCGG - Intronic
1199775724 X:151009703-151009725 GCCCCTCAGCTGCTTCTTCTCGG - Intergenic
1200758777 Y:7016760-7016782 GGCCATCTGCTCCTTTTCCCAGG + Intronic