ID: 1090803451

View in Genome Browser
Species Human (GRCh38)
Location 11:130188617-130188639
Sequence GGCCAGGCTTACAAACTCAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090803451_1090803455 -4 Left 1090803451 11:130188617-130188639 CCACTGAGTTTGTAAGCCTGGCC 0: 1
1: 0
2: 1
3: 7
4: 101
Right 1090803455 11:130188636-130188658 GGCCAGCAAGGTGAAGGACGCGG 0: 1
1: 0
2: 1
3: 15
4: 188
1090803451_1090803458 26 Left 1090803451 11:130188617-130188639 CCACTGAGTTTGTAAGCCTGGCC 0: 1
1: 0
2: 1
3: 7
4: 101
Right 1090803458 11:130188666-130188688 AGCCTGCCCAGAGTCCTGCTGGG 0: 1
1: 0
2: 1
3: 33
4: 235
1090803451_1090803457 25 Left 1090803451 11:130188617-130188639 CCACTGAGTTTGTAAGCCTGGCC 0: 1
1: 0
2: 1
3: 7
4: 101
Right 1090803457 11:130188665-130188687 CAGCCTGCCCAGAGTCCTGCTGG 0: 1
1: 1
2: 1
3: 40
4: 341
1090803451_1090803453 -10 Left 1090803451 11:130188617-130188639 CCACTGAGTTTGTAAGCCTGGCC 0: 1
1: 0
2: 1
3: 7
4: 101
Right 1090803453 11:130188630-130188652 AAGCCTGGCCAGCAAGGTGAAGG 0: 1
1: 0
2: 5
3: 55
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090803451 Original CRISPR GGCCAGGCTTACAAACTCAG TGG (reversed) Exonic
901023478 1:6266989-6267011 GGCCAGGCTTTCAGACTGGGAGG - Intronic
901076816 1:6560393-6560415 GCCCAGGCTTACAGACTAGGGGG + Intronic
901078464 1:6570208-6570230 GCCCAGGCTTACAGACTAGGGGG + Intronic
901447077 1:9315126-9315148 GGCAAGGCTGAGAAGCTCAGCGG + Intronic
901685063 1:10939152-10939174 GGCCAGGCCTACAAACCCAGCGG - Intergenic
904213652 1:28902631-28902653 GGCCAGGCATAGAGACCCAGGGG - Intronic
904369930 1:30042037-30042059 GGCCAGGCCTTCACACTCTGTGG + Intergenic
904868386 1:33600845-33600867 GGCCAGGCTTCCATACTGACCGG + Exonic
910545001 1:88405730-88405752 GGCAAGGTTTACAAACTTGGTGG + Intergenic
910869459 1:91819401-91819423 GGCCTCGCTTACAAGGTCAGTGG - Intronic
911276534 1:95866783-95866805 GAACAGCCTTAAAAACTCAGTGG + Intergenic
912944326 1:114072083-114072105 GGAAGGTCTTACAAACTCAGGGG + Intergenic
920053258 1:203175842-203175864 GTCCAGGCTTATATAGTCAGGGG + Intergenic
1067153488 10:43755059-43755081 GTGCAGGTTTACAAGCTCAGGGG - Intergenic
1070802764 10:79253330-79253352 GTGCAGGCTTACAAACACACTGG + Intronic
1071250071 10:83808846-83808868 GGACAGACGTACCAACTCAGTGG - Intergenic
1073151079 10:101311825-101311847 GAACTGGCATACAAACTCAGGGG - Intergenic
1073869693 10:107849040-107849062 GGCCAGGGAAACAAACTCACTGG + Intergenic
1074203639 10:111261214-111261236 TGCCAGGCTTACGACCTCAGAGG - Intergenic
1088524595 11:110739034-110739056 GACCAAGGTTACAAACTCAAAGG - Intergenic
1090614319 11:128501117-128501139 GTCCAGGTTTCCAAACTCCGTGG + Intronic
1090803451 11:130188617-130188639 GGCCAGGCTTACAAACTCAGTGG - Exonic
1096197792 12:49659754-49659776 GGCCAAGATCACAAACTCACAGG + Intronic
1100038951 12:90288760-90288782 AGCCAGGCATACAAATTCAGTGG - Intergenic
1103340137 12:120216696-120216718 GGCCAGTCTTCCAAAGTCACAGG + Intronic
1107687817 13:42921803-42921825 CGCCAGGCTTACAAACACCCAGG + Intronic
1108247424 13:48532399-48532421 GGCCCGGCTCACTAACTCAGTGG - Intronic
1108745319 13:53387587-53387609 GCCCAGGTCTATAAACTCAGGGG + Intergenic
1108969559 13:56356017-56356039 GACATGGCTTGCAAACTCAGTGG - Intergenic
1116356772 14:43939411-43939433 GGCCAGACTCACACACGCAGCGG + Intergenic
1119512538 14:75222667-75222689 GGCCACTCTTACAGACTAAGGGG - Intergenic
1124819832 15:33033814-33033836 GTCCAGGCTTCCAAATTCAATGG + Intronic
1125831085 15:42717658-42717680 GGCCAGACTGACTAACCCAGGGG + Intronic
1126494064 15:49271060-49271082 CGGCAGGCTTACAATCTCTGTGG - Intronic
1127884165 15:63184470-63184492 GGCCAGGCTTCCAATCTGATTGG - Intergenic
1128752354 15:70158620-70158642 GGCCAGGGCTCCACACTCAGTGG - Intergenic
1136021395 16:27442722-27442744 GATCAGGATTGCAAACTCAGGGG - Intronic
1137605723 16:49785776-49785798 TGCCAGGGTCACAAACTCAAAGG - Intronic
1138562331 16:57809079-57809101 GGCCAGGCTGACCAACTCCTGGG - Intronic
1141275033 16:82579638-82579660 GGCCATGCTTAGAAAATCAAGGG - Intergenic
1141632873 16:85298228-85298250 GGCCAGGCTCTCAGACTCAGAGG - Intergenic
1145813717 17:27780925-27780947 GCCCGGGCTTACAGACTCACAGG - Intronic
1146213173 17:30957738-30957760 GGACAGGCGTACAAAGACAGAGG - Intronic
1147004118 17:37387951-37387973 GGCCAGGAGTTCAAGCTCAGCGG + Intronic
1149607665 17:57936237-57936259 GGCCAGGCTTGTGCACTCAGGGG - Intronic
1149939569 17:60849162-60849184 GGCCAGGCTAGCAAGCTGAGAGG + Intronic
1152417767 17:80174125-80174147 GGCCAGGCTCTCAAACTCCTGGG - Intronic
1155341546 18:24818885-24818907 GGACAGGCTTTCAGACACAGAGG - Intergenic
1156442616 18:37206709-37206731 TGCCAAGCTTAAAAACTCATGGG + Intronic
1163115298 19:15185383-15185405 AGCCAGGCTCACACACACAGCGG + Exonic
926149367 2:10416083-10416105 GCCCAGGCCCTCAAACTCAGTGG + Intronic
928780139 2:34808185-34808207 TGCAAGGCTTTTAAACTCAGAGG + Intergenic
931555574 2:63499957-63499979 AGCCAGAGTTACAAACTGAGGGG - Intronic
931690524 2:64831485-64831507 GCCCAGGCTGAGCAACTCAGTGG - Intergenic
932414673 2:71566406-71566428 GGCGGGGCTCATAAACTCAGTGG - Intronic
935202222 2:100867749-100867771 GGCCAGTCTCACAAACTCCTGGG + Intronic
935331985 2:101984024-101984046 ATCAAGGCTTACAAACTCACGGG + Intergenic
944355941 2:198787979-198788001 GACCTGGCTTACAATATCAGGGG - Intergenic
944894522 2:204150665-204150687 GAGCAGGCTCACCAACTCAGGGG + Intergenic
944949972 2:204737259-204737281 GGCCACGATTAAAAAGTCAGTGG - Intronic
1168857153 20:1016731-1016753 GGCCTGGCTCACAGACCCAGCGG - Intergenic
1170926019 20:20724972-20724994 TGTCAGGCTCACAAAATCAGTGG + Intergenic
1172392346 20:34574473-34574495 GGACAGGCTTCCCAGCTCAGGGG + Intronic
1173983922 20:47246305-47246327 GCCCAAGCCTACAAACCCAGTGG - Exonic
1182529379 22:30943623-30943645 GGCCAGGCTAAGCACCTCAGGGG + Intronic
950458772 3:13108640-13108662 GCTCAGGATTCCAAACTCAGAGG - Intergenic
952507682 3:34022241-34022263 GGCCAGGATGACCAACTCAGTGG - Intergenic
954153605 3:48672407-48672429 GGCCAGGTGCACAAACTCACTGG - Intergenic
956120939 3:65965195-65965217 GACCAGACATACAAACTCCGAGG + Intronic
957638492 3:82817613-82817635 GGCTAGGATTTGAAACTCAGGGG - Intergenic
959968742 3:112384687-112384709 GAGCTGGCATACAAACTCAGAGG + Intergenic
961266622 3:125648066-125648088 GGGCAGGCTCACAAAGTGAGGGG + Intergenic
963345958 3:144096964-144096986 GGCCAGGCTCACAAGCCCAGGGG - Intergenic
968419095 4:467799-467821 GGCCACTCGTACACACTCAGAGG + Intronic
969108584 4:4827235-4827257 GCCCAGGCTGACAAAGGCAGGGG + Intergenic
969440945 4:7216476-7216498 GGCCAGAAGTCCAAACTCAGTGG + Intronic
969845750 4:9918749-9918771 GGCCTGGCTTCCCATCTCAGTGG - Intronic
971651284 4:29278753-29278775 AGCCAGGCTTGCAGAGTCAGTGG + Intergenic
973269093 4:48242894-48242916 GACCAAACTTACAAACTCTGTGG + Intronic
987999195 5:25328637-25328659 TGGCAGGCTTACAAATTCAAAGG + Intergenic
988252177 5:28773426-28773448 AGACAGGATTACAAATTCAGGGG + Intergenic
988365902 5:30298612-30298634 GCCCAGGCTTTCAAACTCCTGGG - Intergenic
995133785 5:108658948-108658970 AGACTGGCTAACAAACTCAGAGG - Intergenic
998457397 5:142284000-142284022 GACCAGACTTCCAAACTCACAGG + Intergenic
1005943216 6:30576836-30576858 GGCTAAGCTTACAGACTGAGGGG - Intronic
1006757331 6:36427836-36427858 GGCCAGCCATACAAACCAAGGGG + Intronic
1008665852 6:53715717-53715739 GCCCAGCCTAAAAAACTCAGAGG + Intergenic
1016431173 6:143987673-143987695 GGCCAGCGTGACAGACTCAGGGG + Intronic
1017163641 6:151389641-151389663 ATCAAGGCTCACAAACTCAGTGG + Intronic
1018105077 6:160478085-160478107 CTCCAGGATGACAAACTCAGCGG + Intergenic
1018113192 6:160556980-160557002 CCCCAGGATGACAAACTCAGCGG + Intronic
1018420314 6:163635161-163635183 GGCCATGCTTTCAAACTCAAAGG + Intergenic
1019906615 7:4069768-4069790 GGCTAGGGTGACAAACACAGTGG - Intronic
1022970180 7:35509972-35509994 AGCCAGGCTTGCAAACTCCCTGG + Intergenic
1025799706 7:64774326-64774348 GGCCAGTCATACACACTGAGGGG - Intergenic
1026990319 7:74581431-74581453 GGCCAGGGTCACAAGCCCAGTGG - Intronic
1034952052 7:155305223-155305245 GGTTAGGCTTAGAACCTCAGAGG - Intronic
1039252907 8:35686355-35686377 AGACAGGCTTACAAAAGCAGTGG - Intronic
1047138911 8:122113353-122113375 GGGCAGGCTTAAAAAGCCAGAGG + Intergenic
1051352939 9:16215363-16215385 GGCCACGCTTTCAACCCCAGAGG + Intronic
1060861194 9:126956257-126956279 GGCCAGGCTAACCCCCTCAGTGG + Intronic
1061837977 9:133341842-133341864 TGCCAGGCCTGCCAACTCAGGGG - Intronic
1189335217 X:40166925-40166947 GTCCAGCCTGACAAAGTCAGAGG - Intronic
1189383787 X:40520540-40520562 GGCCAGGCCAATAAACACAGAGG + Intergenic
1189700232 X:43711073-43711095 GGCCAGTCATACACTCTCAGAGG - Intronic
1191925102 X:66300485-66300507 GGCCATGAGAACAAACTCAGTGG - Intergenic
1192168616 X:68841110-68841132 GGCCAGGCTCACAAAGCCTGGGG - Exonic
1193348691 X:80432442-80432464 TGCCAGACTTAAAGACTCAGGGG - Intronic
1195354090 X:104022168-104022190 TGGCAGGCTGACAAACTCAAAGG + Intergenic
1199242637 X:145565616-145565638 GGTCAGCCTTACAGACACAGAGG + Intergenic